Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_37700_PI390587928Hv_44K_v2TTATTGCTAGGTCGCAAATGTTGCAGCAGAGCAGTTGCCATGTGTTGCAGCAACAATGTT385GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0130.0140.1602.8066.70011.079
Raw 22.23939.482489.61012353.38710642.01019285.567



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_75622.116516e-241272 - 133010059 / 59minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
MLOCMLOC_22764.110837e-23496 - 5559859 / 60minus ABC00069 ABC00241 ABC00282 ABC00295 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC53012
MLOCMLOC_22496.19987e-23691 - 7509859 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC52892 ABC53012
MLOCMLOC_47363.14073e-22159 - 2179858 / 59minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_6381.110353e-21517 - 5769758 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
JLOC1JLOC1_50450.110843e-24705 - 76310059 / 59minus
JLOC1JLOC1_15771.111314e-23544 - 6039859 / 60minus
JLOC1JLOC1_15597.18604e-23553 - 6129859 / 60minus
JLOC1JLOC1_30552.14071e-22159 - 2179858 / 59minus
JLOC1JLOC1_4154.110672e-21540 - 5999758 / 60minus
JLOC1JLOC1_29821.18406e-21160 - 2189757 / 59plus
JLOC1JLOC1_29820.16026e-21385 - 4439757 / 59minus
JLOC1JLOC1_19111.13216e-2185 - 1439757 / 59plus
Harvest21ABC342775733e-25456 - 51510060 / 60plus
Harvest21ABC329985473e-25281 - 34010060 / 60plus
Harvest21ABC328225703e-25366 - 42510060 / 60plus
Harvest21ABC007637633e-25497 - 55610060 / 60plus
Harvest21ABC005826893e-25308 - 36710060 / 60plus
Harvest21ABC0054310363e-25431 - 49010060 / 60plus
Harvest21ABC005248743e-25562 - 62110060 / 60plusABC00524
Harvest21ABC002968613e-25392 - 45110060 / 60plus
Harvest21ABC002926843e-25390 - 44910060 / 60plus
Harvest21ABC0028510083e-25406 - 46510060 / 60plus
Harvest21ABC002665653e-25355 - 41410060 / 60plus
Harvest21ABC002648953e-25516 - 57510060 / 60plus
Harvest21ABC0024111193e-25523 - 58210060 / 60plusABC00241
Harvest21ABC002407983e-25386 - 44510060 / 60plus
Harvest21ABC0023211323e-25546 - 60510060 / 60plus
Harvest21ABC002146983e-25379 - 43810060 / 60plus
Harvest21ABC530128681e-24328 - 38610059 / 59plusABC53012
Harvest21ABC452713291e-24243 - 30110059 / 59plus
Harvest21ABC447154901e-24419 - 47710059 / 59plus
Harvest21ABC0081529001e-241040 - 109810059 / 59plusABC00815
Harvest21ABC005609711e-24401 - 45910059 / 59plus
Harvest21ABC005298041e-24242 - 30010059 / 59plus
Harvest21ABC005286021e-24253 - 31110059 / 59plus
Harvest21ABC005085961e-24378 - 43610059 / 59plus
Harvest21ABC450275401e-23300 - 3599859 / 60plus
Harvest21ABC344616331e-23314 - 3739859 / 60plus
Harvest21ABC341595481e-23344 - 4039859 / 60plus
Harvest21ABC341377021e-23446 - 5059859 / 60plus
Harvest21ABC340566201e-23420 - 4799859 / 60plus
Harvest21ABC331104911e-23301 - 3609859 / 60plus
Harvest21ABC326704501e-23248 - 3079859 / 60plus
Harvest21ABC324546841e-23428 - 4879859 / 60plus
Harvest21ABC324525881e-23502 - 5619859 / 60plus
Harvest21ABC322925821e-23378 - 4379859 / 60plus
Harvest21ABC0082214171e-23831 - 8909859 / 60plusABC00822
Harvest21ABC0081814111e-23775 - 8349859 / 60plus
Harvest21ABC005169931e-23393 - 4529859 / 60plusABC00516
Harvest21ABC002585971e-23331 - 3909859 / 60plus
Harvest21ABC002527011e-23459 - 5189859 / 60plus
Harvest21ABC002435891e-23319 - 3789859 / 60plus
Harvest21ABC000699631e-23368 - 4279859 / 60plusABC00069
Harvest21ABC529056725e-23324 - 3829858 / 59plus
Harvest21ABC528285305e-23285 - 3439858 / 59plus
Harvest21ABC527065895e-23342 - 4009858 / 59plus
Harvest21ABC008056715e-23399 - 4579858 / 59plus
Harvest21ABC0078910725e-23482 - 5409858 / 59plus
Harvest21ABC007626935e-23420 - 4789858 / 59plus
Harvest21ABC007598305e-23420 - 4789858 / 59plus
Harvest21ABC007516695e-23329 - 3879858 / 59plus
Harvest21ABC0057710915e-23496 - 5549858 / 59plus
Harvest21ABC005409775e-23389 - 4479858 / 59plusABC00540
Harvest21ABC529095392e-22418 - 4759857 / 58plus
Harvest21ABC527076452e-22276 - 3339857 / 58plus
Harvest21ABC0028211122e-22523 - 5809857 / 58plusABC00282
Harvest21ABC529085786e-22458 - 5179758 / 60plus
Harvest21ABC528244276e-22336 - 3959758 / 60plus
Harvest21ABC528215636e-22410 - 4699758 / 60plus
Harvest21ABC527806686e-22434 - 4939758 / 60plus
Harvest21ABC527725976e-22434 - 4939758 / 60plus
Harvest21ABC527005486e-22484 - 5439758 / 60plus
Harvest21ABC440124926e-22325 - 3849758 / 60plus
Harvest21ABC436276296e-22434 - 4939758 / 60plus
Harvest21ABC328435656e-22337 - 3969758 / 60plus
Harvest21ABC007986316e-22424 - 4839758 / 60plus
Harvest21ABC007957856e-22530 - 5899758 / 60plus
Harvest21ABC007859996e-22404 - 4639758 / 60plusABC00785
Harvest21ABC005859206e-22369 - 4289758 / 60plusABC00585
Harvest21ABC005486386e-22388 - 4479758 / 60plus
Harvest21ABC529545572e-21153 - 2119757 / 59plus
Harvest21ABC452964542e-21385 - 4439757 / 59plus
Harvest21ABC450546612e-21466 - 5249757 / 59plus
Harvest21ABC438506002e-21339 - 3979757 / 59plus
Harvest21ABC435994572e-21386 - 4449757 / 59plus
Harvest21ABC435565122e-21310 - 3689757 / 59plus
Harvest21ABC344846762e-21220 - 2789757 / 59plus
Harvest21ABC344377302e-21508 - 5669757 / 59plus
Harvest21ABC343247112e-21366 - 4249757 / 59plus
Harvest21ABC343026922e-21442 - 5009757 / 59plus
Harvest21ABC342996782e-21255 - 3139757 / 59plus
Harvest21ABC340336322e-21172 - 2309757 / 59plus
Harvest21ABC330426602e-21500 - 5589757 / 59plus
Harvest21ABC329315222e-21330 - 3889757 / 59plus
Harvest21ABC329295512e-21482 - 5409757 / 59plus
Harvest21ABC328325082e-21309 - 3679757 / 59plus
Harvest21ABC328045412e-21442 - 5009757 / 59plus
Harvest21ABC326526282e-21484 - 5429757 / 59plus
Harvest21ABC322704682e-21265 - 3239757 / 59plus
Harvest21ABC298376812e-21386 - 4449757 / 59plus
Harvest21ABC0078111722e-21573 - 6319757 / 59plus
Harvest21ABC007766002e-21346 - 4049757 / 59plus
Harvest21ABC007618322e-21594 - 6529757 / 59plus
Harvest21ABC005745022e-21375 - 4339757 / 59plus
Harvest21ABC005599062e-21318 - 3769757 / 59plus
Harvest21ABC005345452e-21385 - 4439757 / 59plus
Harvest21ABC005317042e-21332 - 3909757 / 59plus
Harvest21ABC0053010962e-21512 - 5709757 / 59plusABC00530
Harvest21ABC0052312352e-21637 - 6959757 / 59plusABC00523
Harvest21ABC0050612022e-21609 - 6679757 / 59plus
Harvest21ABC005056202e-21419 - 4779757 / 59plus
Harvest21ABC0050210712e-21487 - 5459757 / 59plusABC00502
Harvest21ABC003044372e-21306 - 3649757 / 59plus
Harvest21ABC003027132e-21370 - 4289757 / 59plus
Harvest21ABC003019702e-21378 - 4369757 / 59plusABC00301
Harvest21ABC002876302e-21504 - 5629757 / 59plus
Harvest21ABC002836712e-21470 - 5289757 / 59plus
Harvest21ABC0025910112e-21423 - 4819757 / 59plus
Harvest21ABC002565912e-21465 - 5239757 / 59plus
Harvest21ABC002475802e-21479 - 5379757 / 59plus
Harvest21ABC002446202e-21488 - 5469757 / 59plus
Harvest21ABC0021115152e-21599 - 6579757 / 59plus
Harvest21ABC000225052e-21410 - 4689757 / 59plus
Harvest35U35_381696083e-25406 - 46510060 / 60plus
Harvest35U35_372565473e-25281 - 34010060 / 60plus
Harvest35U35_371555703e-25366 - 42510060 / 60plus
Harvest35U35_34214173e-25831 - 89010060 / 60plus
Harvest35U35_2266913e-25308 - 36710060 / 60plus
Harvest35U35_1149743e-25390 - 44910060 / 60plus
Harvest35U35_905653e-25355 - 41410060 / 60plus
Harvest35U35_7911203e-25523 - 58210060 / 60plus
Harvest35U35_784883e-25386 - 44510060 / 60plus
Harvest35U35_7511413e-25543 - 60210060 / 60plus
Harvest35U35_33729001e-241040 - 109810059 / 59plus
Harvest35U35_2026521e-24242 - 30010059 / 59plus
Harvest35U35_1985981e-24378 - 43610059 / 59plus
Harvest35U35_384776331e-23314 - 3739859 / 60plus
Harvest35U35_382497021e-23446 - 5059859 / 60plus
Harvest35U35_381946201e-23420 - 4799859 / 60plus
Harvest35U35_33913791e-23775 - 8349859 / 60plus
Harvest35U35_876021e-23336 - 3959859 / 60plus
Harvest35U35_847011e-23459 - 5189859 / 60plus
Harvest35U35_815891e-23319 - 3789859 / 60plus
Harvest35U35_259391e-23368 - 4279859 / 60plus
Harvest35U35_3306715e-23399 - 4579858 / 59plus
Harvest35U35_32110895e-23482 - 5409858 / 59plus
Harvest35U35_31210465e-23698 - 7569858 / 59plus
Harvest35U35_3066935e-23420 - 4789858 / 59plus
Harvest35U35_3045775e-23420 - 4789858 / 59plus
Harvest35U35_3006695e-23329 - 3879858 / 59plus
Harvest35U35_2119845e-23389 - 4479858 / 59plus
Harvest35U35_8210855e-23488 - 5469858 / 59plus
Harvest35U35_506425786e-22458 - 5179758 / 60plus
Harvest35U35_505175486e-22484 - 5439758 / 60plus
Harvest35U35_451486296e-22434 - 4939758 / 60plus
Harvest35U35_3276316e-22424 - 4839758 / 60plus
Harvest35U35_3197246e-22404 - 4639758 / 60plus
Harvest35U35_2136386e-22387 - 4469758 / 60plus
Harvest35U35_506635572e-21153 - 2119757 / 59plus
Harvest35U35_451115122e-21310 - 3689757 / 59plus
Harvest35U35_384577302e-21508 - 5669757 / 59plus
Harvest35U35_383606922e-21442 - 5009757 / 59plus
Harvest35U35_383576782e-21255 - 3139757 / 59plus
Harvest35U35_381766322e-21172 - 2309757 / 59plus
Harvest35U35_372806602e-21500 - 5589757 / 59plus
Harvest35U35_372165222e-21330 - 3889757 / 59plus
Harvest35U35_372145512e-21482 - 5409757 / 59plus
Harvest35U35_371595082e-21309 - 3679757 / 59plus
Harvest35U35_371435412e-21442 - 5009757 / 59plus
Harvest35U35_3296172e-21485 - 5439757 / 59plus
Harvest35U35_3189772e-21521 - 5799757 / 59plus
Harvest35U35_3139342e-21346 - 4049757 / 59plus
Harvest35U35_2276612e-21466 - 5249757 / 59plus
Harvest35U35_2185992e-21318 - 3769757 / 59plus
Harvest35U35_2079052e-21384 - 4429757 / 59plus
Harvest35U35_2066022e-21341 - 3999757 / 59plus
Harvest35U35_2035832e-21512 - 5709757 / 59plus
Harvest35U35_19712062e-21609 - 6679757 / 59plus
Harvest35U35_1966852e-21420 - 4789757 / 59plus
Harvest35U35_1096302e-21504 - 5629757 / 59plus
Harvest35U35_1066712e-21470 - 5289757 / 59plus
Harvest35U35_887202e-21423 - 4819757 / 59plus
Harvest35U35_776332e-21489 - 5479757 / 59plus
Harvest35U35_689552e-21545 - 6039757 / 59plus
Harvest35U35_247292e-21386 - 4449757 / 59plus



Contig Sequence (488 bp)

>U35_78 488 Hv_44K_v2
GCAAAACCAAGAAACACTAGTTAACACCAATCCACTATGAAGACCTTCCTCATCTTTGCA
CTCCTCGCCATTGCGGCAACAAGTACGATTGCACAGCAACAACCATTTCCACAACAACCC
ATCCCACAACAGCCACAACCATACCCACAACAACCACAACCATATCCACAACAACCCTTC
CAACCGCAACAACCATTTCCACAACAAACCATCCCACAACAACAACAACCATGTACACCA
CAACAAACACCACTCCCACAAGGACAACTGTACCAAACGCTTCTGCAACTACAAATACCC
TATGTTCAACCATCTATTTTGCAACAGCTAAACCCATGCAAGGTATTCCTCCAGCAGCAG
TGCAGCCCCGTGCGAATGCCACAACTTATTGCTAGGTCGCAAATGTTGCAGCAGAGCAGT
TGCCATGTGTTGCAGCAACAATGTTGCCAGCAACTGCCGCAAATCCCCGAACAATTCCGC
CATGAGGC



Homology of Contig U35_78 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None