Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_37062_PI390587928Hv_44K_v2TCACAAATGTTGCAACAGAGCAGTTGCCATGTGTTGCAGCAACAATGTTGCCAACAACTG477GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0130.0120.1502.6916.14510.147
Raw 8.41613.253176.7804721.5233790.9106826.907



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_28499.13217e-2398 - 15410057 / 57plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_27672.12367e-2328 - 8410057 / 57plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_47363.14073e-21148 - 2049856 / 57minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_22496.19983e-21680 - 7399758 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC52892 ABC53012
JLOC1JLOC1_19111.13214e-2398 - 15410057 / 57plus
JLOC1JLOC1_18660.12364e-2328 - 8410057 / 57plus
JLOC1JLOC1_30552.14072e-21148 - 2049856 / 57minus
JLOC1JLOC1_15597.18602e-21542 - 6019758 / 60minus
Harvest21ABC298296343e-25408 - 46710060 / 60plus
Harvest21ABC0076512403e-25716 - 77510060 / 60plusABC00765
Harvest21ABC437355711e-24230 - 28810059 / 59plus
Harvest21ABC452964541e-23398 - 45410057 / 57plus
Harvest21ABC450546611e-23479 - 53510057 / 57plus
Harvest21ABC438506001e-23352 - 40810057 / 57plus
Harvest21ABC435994571e-23399 - 45510057 / 57plus
Harvest21ABC435565121e-23323 - 37910057 / 57plus
Harvest21ABC344846761e-23233 - 28910057 / 57plus
Harvest21ABC344377301e-23521 - 57710057 / 57plus
Harvest21ABC343247111e-23379 - 43510057 / 57plus
Harvest21ABC343026921e-23455 - 51110057 / 57plus
Harvest21ABC342996781e-23268 - 32410057 / 57plus
Harvest21ABC340336321e-23185 - 24110057 / 57plus
Harvest21ABC330426601e-23513 - 56910057 / 57plus
Harvest21ABC329315221e-23343 - 39910057 / 57plus
Harvest21ABC329295511e-23495 - 55110057 / 57plus
Harvest21ABC328325081e-23322 - 37810057 / 57plus
Harvest21ABC328045411e-23455 - 51110057 / 57plus
Harvest21ABC326526281e-23497 - 55310057 / 57plus
Harvest21ABC322704681e-23278 - 33410057 / 57plus
Harvest21ABC298376811e-23399 - 45510057 / 57plus
Harvest21ABC0078111721e-23586 - 64210057 / 57plus
Harvest21ABC007618321e-23607 - 66310057 / 57plus
Harvest21ABC005745021e-23388 - 44410057 / 57plus
Harvest21ABC005636501e-23378 - 43410057 / 57plus
Harvest21ABC005525351e-23415 - 47110057 / 57plus
Harvest21ABC005498681e-23345 - 40110057 / 57plusABC00549
Harvest21ABC005345451e-23398 - 45410057 / 57plus
Harvest21ABC005317041e-23345 - 40110057 / 57plus
Harvest21ABC0053010961e-23525 - 58110057 / 57plusABC00530
Harvest21ABC0052312351e-23650 - 70610057 / 57plusABC00523
Harvest21ABC0050612021e-23622 - 67810057 / 57plus
Harvest21ABC005056201e-23432 - 48810057 / 57plus
Harvest21ABC003044371e-23319 - 37510057 / 57plus
Harvest21ABC003027131e-23383 - 43910057 / 57plus
Harvest21ABC003019701e-23391 - 44710057 / 57plusABC00301
Harvest21ABC002896221e-23519 - 57510057 / 57plus
Harvest21ABC002876301e-23517 - 57310057 / 57plus
Harvest21ABC002836711e-23483 - 53910057 / 57plus
Harvest21ABC0025910111e-23436 - 49210057 / 57plus
Harvest21ABC002565911e-23478 - 53410057 / 57plus
Harvest21ABC002475801e-23492 - 54810057 / 57plus
Harvest21ABC002465971e-23496 - 55210057 / 57plus
Harvest21ABC002446201e-23501 - 55710057 / 57plus
Harvest21ABC0021115151e-23612 - 66810057 / 57plus
Harvest21ABC000225051e-23423 - 47910057 / 57plus
Harvest21ABC289566056e-22406 - 4629856 / 57plus
Harvest21ABC007726626e-22475 - 5319856 / 57plus
Harvest21ABC0057710916e-22509 - 5659856 / 57plus
Harvest21ABC005409776e-22402 - 4589856 / 57plusABC00540
Harvest21ABC005169936e-22404 - 4639758 / 60plusABC00516
Harvest21ABC000699636e-22379 - 4389758 / 60plusABC00069
Harvest21ABC452713292e-21256 - 3119855 / 56plus
Harvest35U35_236343e-25408 - 46710060 / 60plus
Harvest35U35_86783e-25478 - 53710060 / 60plus
Harvest35U35_452055711e-24230 - 28810059 / 59plus
Harvest35U35_451115121e-23323 - 37910057 / 57plus
Harvest35U35_384577301e-23521 - 57710057 / 57plus
Harvest35U35_383606921e-23455 - 51110057 / 57plus
Harvest35U35_383576781e-23268 - 32410057 / 57plus
Harvest35U35_381766321e-23185 - 24110057 / 57plus
Harvest35U35_372806601e-23513 - 56910057 / 57plus
Harvest35U35_372165221e-23343 - 39910057 / 57plus
Harvest35U35_372145511e-23495 - 55110057 / 57plus
Harvest35U35_371595081e-23322 - 37810057 / 57plus
Harvest35U35_371435411e-23455 - 51110057 / 57plus
Harvest35U35_3296171e-23498 - 55410057 / 57plus
Harvest35U35_3189771e-23534 - 59010057 / 57plus
Harvest35U35_2276611e-23479 - 53510057 / 57plus
Harvest35U35_2079051e-23397 - 45310057 / 57plus
Harvest35U35_2066021e-23354 - 41010057 / 57plus
Harvest35U35_2047061e-23345 - 40110057 / 57plus
Harvest35U35_2035831e-23525 - 58110057 / 57plus
Harvest35U35_19712061e-23622 - 67810057 / 57plus
Harvest35U35_1966851e-23433 - 48910057 / 57plus
Harvest35U35_1157111e-23379 - 43510057 / 57plus
Harvest35U35_1096301e-23517 - 57310057 / 57plus
Harvest35U35_1066711e-23483 - 53910057 / 57plus
Harvest35U35_887201e-23436 - 49210057 / 57plus
Harvest35U35_776331e-23502 - 55810057 / 57plus
Harvest35U35_689551e-23558 - 61410057 / 57plus
Harvest35U35_247291e-23399 - 45510057 / 57plus
Harvest35U35_296006056e-22406 - 4629856 / 57plus
Harvest35U35_30210806e-22842 - 8989856 / 57plus
Harvest35U35_2119846e-22402 - 4589856 / 57plus
Harvest35U35_8210856e-22501 - 5579856 / 57plus
Harvest35U35_259396e-22379 - 4389758 / 60plus



Contig Sequence (678 bp)

>U35_8 678 Hv_44K_v2
CAACAACCATACCCACAACAACCACAACCATTTCCACAACAACTCATCCCACAACAACCA
CAACCATTTCCACAACAACCACAACCATACCCACAACAACCACAACCATTTCCACAACAG
CCCATCCCACAACAACCACAACCATACCCACAACAACCACAACCATTTCCGCAACAACCC
ATCCCACAACAACCACAACCATACCCACAACAACCACAACCATTTCCACAACAACCCTTC
CCATCACAACAACCATTTCCACAACAACCACCATTTTGGCAACAACAACCAGTTCTATCG
CAGCAACAACCATGTACACAAGACCAAAGACCACTCCTACAAGAACAACAAGATCAAATG
CTTGTGCAAGTACAAATACCATTTGTTCATCCATCTATTTTGCAGCAGCTAAACCCATGC
AAGGTATTCCTCCAGCAGCAGTGTAGCCCTGTGGCAATGTCACAACGTATTGCAAGGTCA
CAAATGTTGCAACAGAGCAGTTGCCATGTGTTGCAGCAACAATGTTGCCAACAACTGCCG
CAAATCCCCGAACAAATCCGCCATGAGGCAGTCCGTGCAATCGTCTACTCTATCGTCCTG
CAAGAACAACCCCTACAATTGGTCCAAGGTGTCTCCCAACCCCAACAACAGTCACAACAG
CAACAAGTCGGACAATGT



Homology of Contig U35_8 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None