Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_22614_PI390587928Hv_44K_v2AACAATTCCGCCATGAGGCAATCCGTGCAATCGTCTACTCTATCTTTCTGCAAGAACAAC503GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0130.0120.1602.5296.1439.327
Raw 58.76085.4681519.53734194.10030246.86750815.067



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_22764.110832e-24412 - 47110060 / 60minus ABC00069 ABC00241 ABC00282 ABC00295 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC53012
MLOCMLOC_6381.110352e-24433 - 49210060 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
MLOCMLOC_46003.113793e-21243 - 3029758 / 60plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
MLOCMLOC_22496.19983e-21607 - 6669758 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC52892 ABC53012
JLOC1JLOC1_15771.111318e-25460 - 51910060 / 60minus
JLOC1JLOC1_4154.110678e-25456 - 51510060 / 60minus
JLOC1JLOC1_29821.18402e-21243 - 3029758 / 60plus
JLOC1JLOC1_29820.16022e-21301 - 3609758 / 60minus
JLOC1JLOC1_15597.18602e-21469 - 5289758 / 60minus
JLOC1JLOC1_30556.18546e-21447 - 5059757 / 59minus
Harvest21ABC527806683e-25518 - 57710060 / 60plus
Harvest21ABC527725973e-25518 - 57710060 / 60plus
Harvest21ABC450275403e-25384 - 44310060 / 60plus
Harvest21ABC436276293e-25518 - 57710060 / 60plus
Harvest21ABC344616333e-25398 - 45710060 / 60plus
Harvest21ABC341595483e-25428 - 48710060 / 60plus
Harvest21ABC341377023e-25530 - 58910060 / 60plus
Harvest21ABC340566203e-25504 - 56310060 / 60plus
Harvest21ABC331104913e-25385 - 44410060 / 60plus
Harvest21ABC329985473e-25365 - 42410060 / 60plus
Harvest21ABC328225703e-25450 - 50910060 / 60plus
Harvest21ABC326704503e-25332 - 39110060 / 60plus
Harvest21ABC324546843e-25512 - 57110060 / 60plus
Harvest21ABC322925823e-25462 - 52110060 / 60plus
Harvest21ABC0082214173e-25915 - 97410060 / 60plusABC00822
Harvest21ABC0081814113e-25859 - 91810060 / 60plus
Harvest21ABC007986313e-25508 - 56710060 / 60plus
Harvest21ABC007957853e-25614 - 67310060 / 60plus
Harvest21ABC007859993e-25488 - 54710060 / 60plusABC00785
Harvest21ABC007637633e-25581 - 64010060 / 60plus
Harvest21ABC005859203e-25453 - 51210060 / 60plusABC00585
Harvest21ABC005826893e-25392 - 45110060 / 60plus
Harvest21ABC005486383e-25472 - 53110060 / 60plus
Harvest21ABC0054310363e-25515 - 57410060 / 60plus
Harvest21ABC005248743e-25646 - 70510060 / 60plusABC00524
Harvest21ABC002968613e-25476 - 53510060 / 60plus
Harvest21ABC002926843e-25474 - 53310060 / 60plus
Harvest21ABC0028510083e-25490 - 54910060 / 60plus
Harvest21ABC002697683e-25589 - 64810060 / 60plus
Harvest21ABC002648953e-25600 - 65910060 / 60plus
Harvest21ABC002585973e-25415 - 47410060 / 60plus
Harvest21ABC002527013e-25543 - 60210060 / 60plus
Harvest21ABC002435893e-25403 - 46210060 / 60plus
Harvest21ABC002407983e-25470 - 52910060 / 60plus
Harvest21ABC002377343e-2561 - 12010060 / 60minus
Harvest21ABC0023211323e-25630 - 68910060 / 60plus
Harvest21ABC002146983e-25463 - 52210060 / 60plus
Harvest21ABC328435651e-23421 - 4809859 / 60plus
Harvest21ABC002665651e-23439 - 4989859 / 60plus
Harvest21ABC0024111191e-23607 - 6669859 / 60plusABC00241
Harvest21ABC528215635e-23494 - 5529859 / 60plus
Harvest21ABC529056726e-22407 - 4669758 / 60plus
Harvest21ABC528285306e-22368 - 4279758 / 60plus
Harvest21ABC527076456e-22358 - 4179758 / 60plus
Harvest21ABC527065896e-22425 - 4849758 / 60plus
Harvest21ABC455102316e-2260 - 1199758 / 60plus
Harvest21ABC325384946e-2266 - 1259758 / 60plus
Harvest21ABC008056716e-22482 - 5419758 / 60plus
Harvest21ABC0078910726e-22565 - 6249758 / 60plus
Harvest21ABC007626936e-22503 - 5629758 / 60plus
Harvest21ABC007598306e-22503 - 5629758 / 60plus
Harvest21ABC007516696e-22412 - 4719758 / 60plus
Harvest21ABC005599066e-22401 - 4609758 / 60plus
Harvest21ABC005169936e-22477 - 5369758 / 60plusABC00516
Harvest21ABC0028211126e-22605 - 6649758 / 60plusABC00282
Harvest21ABC000699636e-22452 - 5119758 / 60plusABC00069
Harvest35U35_451486293e-25518 - 57710060 / 60plus
Harvest35U35_384776333e-25398 - 45710060 / 60plus
Harvest35U35_382497023e-25530 - 58910060 / 60plus
Harvest35U35_381946203e-25504 - 56310060 / 60plus
Harvest35U35_381696083e-25490 - 54910060 / 60plus
Harvest35U35_372565473e-25365 - 42410060 / 60plus
Harvest35U35_371555703e-25450 - 50910060 / 60plus
Harvest35U35_34214173e-25915 - 97410060 / 60plus
Harvest35U35_33913793e-25859 - 91810060 / 60plus
Harvest35U35_3276313e-25508 - 56710060 / 60plus
Harvest35U35_3197243e-25488 - 54710060 / 60plus
Harvest35U35_2266913e-25392 - 45110060 / 60plus
Harvest35U35_2136383e-25471 - 53010060 / 60plus
Harvest35U35_1149743e-25474 - 53310060 / 60plus
Harvest35U35_876023e-25420 - 47910060 / 60plus
Harvest35U35_847013e-25543 - 60210060 / 60plus
Harvest35U35_815893e-25403 - 46210060 / 60plus
Harvest35U35_7511413e-25627 - 68610060 / 60plus
Harvest35U35_905651e-23439 - 4989859 / 60plus
Harvest35U35_7911201e-23607 - 6669859 / 60plus
Harvest35U35_3306716e-22482 - 5419758 / 60plus
Harvest35U35_32110896e-22565 - 6249758 / 60plus
Harvest35U35_31210466e-22781 - 8409758 / 60plus
Harvest35U35_3066936e-22503 - 5629758 / 60plus
Harvest35U35_3045776e-22503 - 5629758 / 60plus
Harvest35U35_3006696e-22412 - 4719758 / 60plus
Harvest35U35_2185996e-22401 - 4609758 / 60plus
Harvest35U35_259396e-22452 - 5119758 / 60plus



Contig Sequence (620 bp)

>U35_38194 620 Hv_44K_v2
GAAACCAAGAAACACTAGTTAACACCAATCCACTATGAAGACCTTCCTCATCTTTGCACT
CCTCGTCATTGCGGCAACAAGTACGATTGCACAGCAACAACCATTTCCACAACAAACCAT
CCCACAACAACCACAACCATATCCACAACAACCCTTCCCACCGCAACAAGAATTTCCACA
ACAACCACCATTTTGGCCACAACAACCATTTCCACAGCAACCACCATTTGGGCTACAACA
ACCAATTCTATCGCAGCAACAACCATGTACACCACAACAAACACCACTCCCACAAGGACA
ACTGTATCAAACGCTTCTGCAACTACAAATACCCTATGTTCATCCATCTATATTGCAACA
GCTAAACCCATGCAAGGTATTCCTCCAGCAGCAGTGCAGCCCCGTGCGAATGCCACAACT
TATTGCTAGGTTGCAAATGTTGCAGCAGAGCAGTTGCCATGTGTTGCAGCAACAATGTTG
CCAGCAACTGCCGCAAATCTCCGAACAATTCCGCCATGAGGCAATCCGTGCAATCGTCTA
CTCTATCTTTCTGCAAGAACAACCCCAACAGTCGGTCCAAGGTGTATCCCAAACCCAACA
ACAGTTGCAGCAGGAGCAAG



Homology of Contig U35_38194 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None