Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_15916_PI390587928Hv_44K_v2ACAATTCCGCCATGAGGCAATCCGTGCAATCGTCTACTCTATCTTTTTGCAAGAACAACC439GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0130.0130.1602.6286.3459.174
Raw 57.83282.2861499.11234923.96730632.73348917.167



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_22764.110837e-23411 - 4709859 / 60minus ABC00069 ABC00241 ABC00282 ABC00295 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC53012
MLOCMLOC_22496.19987e-23606 - 6659859 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC52892 ABC53012
MLOCMLOC_6381.110357e-23432 - 4919859 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
JLOC1JLOC1_15771.111314e-23459 - 5189859 / 60minus
JLOC1JLOC1_15597.18604e-23468 - 5279859 / 60minus
JLOC1JLOC1_4154.110674e-23455 - 5149859 / 60minus
Harvest21ABC002665653e-25440 - 49910060 / 60plus
Harvest21ABC0024111193e-25608 - 66710060 / 60plusABC00241
Harvest21ABC527806681e-23519 - 5789859 / 60plus
Harvest21ABC527725971e-23519 - 5789859 / 60plus
Harvest21ABC527076451e-23359 - 4189859 / 60plus
Harvest21ABC450275401e-23385 - 4449859 / 60plus
Harvest21ABC436276291e-23519 - 5789859 / 60plus
Harvest21ABC344616331e-23399 - 4589859 / 60plus
Harvest21ABC341595481e-23429 - 4889859 / 60plus
Harvest21ABC341377021e-23531 - 5909859 / 60plus
Harvest21ABC340566201e-23505 - 5649859 / 60plus
Harvest21ABC331104911e-23386 - 4459859 / 60plus
Harvest21ABC329985471e-23366 - 4259859 / 60plus
Harvest21ABC328225701e-23451 - 5109859 / 60plus
Harvest21ABC326704501e-23333 - 3929859 / 60plus
Harvest21ABC325384941e-2367 - 1269859 / 60plus
Harvest21ABC324546841e-23513 - 5729859 / 60plus
Harvest21ABC322925821e-23463 - 5229859 / 60plus
Harvest21ABC0082214171e-23916 - 9759859 / 60plusABC00822
Harvest21ABC0081814111e-23860 - 9199859 / 60plus
Harvest21ABC007986311e-23509 - 5689859 / 60plus
Harvest21ABC007957851e-23615 - 6749859 / 60plus
Harvest21ABC007859991e-23489 - 5489859 / 60plusABC00785
Harvest21ABC007637631e-23582 - 6419859 / 60plus
Harvest21ABC005859201e-23454 - 5139859 / 60plusABC00585
Harvest21ABC005826891e-23393 - 4529859 / 60plus
Harvest21ABC005486381e-23473 - 5329859 / 60plus
Harvest21ABC0054310361e-23516 - 5759859 / 60plus
Harvest21ABC005248741e-23647 - 7069859 / 60plusABC00524
Harvest21ABC005169931e-23478 - 5379859 / 60plusABC00516
Harvest21ABC002968611e-23477 - 5369859 / 60plus
Harvest21ABC002926841e-23475 - 5349859 / 60plus
Harvest21ABC0028510081e-23491 - 5509859 / 60plus
Harvest21ABC0028211121e-23606 - 6659859 / 60plusABC00282
Harvest21ABC002697681e-23590 - 6499859 / 60plus
Harvest21ABC002648951e-23601 - 6609859 / 60plus
Harvest21ABC002585971e-23416 - 4759859 / 60plus
Harvest21ABC002527011e-23544 - 6039859 / 60plus
Harvest21ABC002435891e-23404 - 4639859 / 60plus
Harvest21ABC002407981e-23471 - 5309859 / 60plus
Harvest21ABC002377341e-2360 - 1199859 / 60minus
Harvest21ABC0023211321e-23631 - 6909859 / 60plus
Harvest21ABC002146981e-23464 - 5239859 / 60plus
Harvest21ABC000699631e-23453 - 5129859 / 60plusABC00069
Harvest21ABC440124926e-22410 - 4699758 / 60plus
Harvest21ABC528215632e-21495 - 5539758 / 60plus
Harvest35U35_905653e-25440 - 49910060 / 60plus
Harvest35U35_7911203e-25608 - 66710060 / 60plus
Harvest35U35_451486291e-23519 - 5789859 / 60plus
Harvest35U35_384776331e-23399 - 4589859 / 60plus
Harvest35U35_382497021e-23531 - 5909859 / 60plus
Harvest35U35_381946201e-23505 - 5649859 / 60plus
Harvest35U35_381696081e-23491 - 5509859 / 60plus
Harvest35U35_372565471e-23366 - 4259859 / 60plus
Harvest35U35_371555701e-23451 - 5109859 / 60plus
Harvest35U35_34214171e-23916 - 9759859 / 60plus
Harvest35U35_33913791e-23860 - 9199859 / 60plus
Harvest35U35_3276311e-23509 - 5689859 / 60plus
Harvest35U35_3197241e-23489 - 5489859 / 60plus
Harvest35U35_2266911e-23393 - 4529859 / 60plus
Harvest35U35_2136381e-23472 - 5319859 / 60plus
Harvest35U35_1149741e-23475 - 5349859 / 60plus
Harvest35U35_876021e-23421 - 4809859 / 60plus
Harvest35U35_847011e-23544 - 6039859 / 60plus
Harvest35U35_815891e-23404 - 4639859 / 60plus
Harvest35U35_7511411e-23628 - 6879859 / 60plus
Harvest35U35_259391e-23453 - 5129859 / 60plus



Contig Sequence (565 bp)

>U35_90 565 Hv_44K_v2
GATCAAAACCAAGAAACACTAGTTAACACCAATCCACCATGAAGACCTTTCTCATCTTTG
CACTCCTTGCCATTGCAGCAACAAGTACCATTGCACAACAACAACCATTTCCACAACAAC
CACCATTTTGGCAACAACAACCATTTCCACAACAACCACCATTTGGGCTACAACAACCAA
TTCTATTGCAGCAACAACTATGTACACCACAACAAACACCACTCCCACAAGGACAACTGT
ACCAAATGCTTATGCAACTACAAATACCCTATGTTCATCCATCTATTTTGCAACAGCTAA
ACCCATGCAAGGTATTCCTCCAGCAGCAATGCAGCCCCGTGCGAATGCCACAACTTATTG
CTAGGTCGCAAATGTTGCAGCAGAGCAGTTGCCATGTGTTGCAGCAACAATGTTGCCAGC
AACTGCCGCAAATTCCCGAACAATTCCGCCATGAGGCAATCCGTGCAATCGTCTACTCTA
TCTTTTTGCAAGAACAACCCCAACAGTCGGTCCAAGGTGTCTCCCAACCCCAACAACAAT
TGCAGCAGGAGCAAGTCGGACAATG



Homology of Contig U35_90 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None