Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_13668_PI390587928Hv_44K_v2ACAAGTCGGACAATGTTCTTTCCAACAACCTCAACCACAACAGGGTCAACAACAGCAAGT450GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0130.0130.1582.4585.4627.612
Raw 93.267142.8912231.41248054.76739987.33361402.033



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_355.15682e-2436 - 9510060 / 60plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC52611 ABC52892 ABC53012
MLOCMLOC_30835.17176e-24251 - 30910059 / 59plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC52892 ABC53012
JLOC1JLOC1_226.15128e-2536 - 9510060 / 60plus
JLOC1JLOC1_20348.16263e-24251 - 30910059 / 59plus
Harvest21ABC374184113e-2557 - 11610060 / 60plus
Harvest21ABC344846763e-25415 - 47410060 / 60plus
Harvest21ABC343247113e-25561 - 62010060 / 60plus
Harvest21ABC342996783e-25450 - 50910060 / 60plus
Harvest21ABC340336323e-25367 - 42610060 / 60plus
Harvest21ABC329494403e-2555 - 11410060 / 60plusABC32949
Harvest21ABC298105993e-25218 - 27710060 / 60plus
Harvest21ABC008115603e-25150 - 20910060 / 60plusABC00811
Harvest21ABC007996813e-25611 - 67010060 / 60plus
Harvest21ABC0079310913e-25687 - 74610060 / 60plusABC00793
Harvest21ABC007838013e-25611 - 67010060 / 60plus
Harvest21ABC0078111723e-25768 - 82710060 / 60plus
Harvest21ABC0076512403e-25901 - 96010060 / 60plusABC00765
Harvest21ABC007576053e-25451 - 51010060 / 60plus
Harvest21ABC005636503e-25560 - 61910060 / 60plus
Harvest21ABC005498683e-25527 - 58610060 / 60plusABC00549
Harvest21ABC005317043e-25527 - 58610060 / 60plus
Harvest21ABC0052312353e-25832 - 89110060 / 60plusABC00523
Harvest21ABC0050612023e-25804 - 86310060 / 60plus
Harvest21ABC0030510303e-25681 - 74010060 / 60plus
Harvest21ABC003027133e-25565 - 62410060 / 60plus
Harvest21ABC003019703e-25573 - 63210060 / 60plusABC00301
Harvest21ABC0025910113e-25618 - 67710060 / 60plus
Harvest21ABC0021115153e-25794 - 85310060 / 60plus
Harvest21ABC007766001e-24542 - 60010059 / 59plus
Harvest21ABC0050210711e-24683 - 74110059 / 59plusABC00502
Harvest21ABC438506001e-23534 - 5939859 / 60plus
Harvest21ABC005566821e-23345 - 4049859 / 60plus
Harvest21ABC0053010961e-23708 - 7679859 / 60plusABC00530
Harvest21ABC447275315e-23348 - 4069858 / 59minusABC44727
Harvest21ABC343026925e-23637 - 69210056 / 56plus
Harvest21ABC298376815e-23581 - 6399859 / 60plus
Harvest21ABC0057710915e-23692 - 7509858 / 59plus
Harvest21ABC005676165e-23217 - 2759858 / 59plusABC00567
Harvest21ABC005409775e-23585 - 6439858 / 59plusABC00540
Harvest21ABC529414772e-21186 - 2419855 / 56plus
Harvest35U35_383576783e-25450 - 50910060 / 60plus
Harvest35U35_381766323e-25367 - 42610060 / 60plus
Harvest35U35_300985993e-25218 - 27710060 / 60plus
Harvest35U35_3325593e-25150 - 20910060 / 60plus
Harvest35U35_3189773e-25716 - 77510060 / 60plus
Harvest35U35_31412353e-25922 - 98110060 / 60plus
Harvest35U35_3036053e-25451 - 51010060 / 60plus
Harvest35U35_2079053e-25579 - 63810060 / 60plus
Harvest35U35_2047063e-25527 - 58610060 / 60plus
Harvest35U35_19712063e-25804 - 86310060 / 60plus
Harvest35U35_1966853e-25615 - 67410060 / 60plus
Harvest35U35_1157113e-25561 - 62010060 / 60plus
Harvest35U35_887203e-25618 - 67710060 / 60plus
Harvest35U35_689553e-25740 - 79910060 / 60plus
Harvest35U35_247293e-25581 - 64010060 / 60plus
Harvest35U35_78283e-25759 - 81810060 / 60plus
Harvest35U35_3139341e-24542 - 60010059 / 59plus
Harvest35U35_8210851e-24684 - 74210059 / 59plus
Harvest35U35_2156831e-23345 - 4049859 / 60plus
Harvest35U35_2066021e-23536 - 5959859 / 60plus
Harvest35U35_383606925e-23637 - 69210056 / 56plus
Harvest35U35_2119845e-23585 - 6439858 / 59plus
Harvest35U35_30210806e-221024 - 10809857 / 58plus



Contig Sequence (605 bp)

>U35_303 605 Hv_44K_v2
ACAACCACAACCATACCCACAACAACCACAACCATTTTCACAACAGCCCATCCCACAACA
ACCACTACCATACCCACAACAACCACAACCATTTCCACAACAACCCATCCCACAACAACC
ACAACCATACCCACAACAAGATCAAATGCTTGTGCAAGTACAAATACCATTTGTTCATCC
ATCTATTTTGCAGCAGCTAAACCCATGCAAGGTATTCCTCCAGCAGCAGTGCAGCCCTGT
GGCAATGTCACAACGTATTGCAAGGTCGCAGATGTTGCAACAGAGCAGTTGCCATGTGTT
GCAGCAACAGTGTTGCCAACAACTGCCGCAAATCCCCGAACAACTCCGCCATGAGGCAGT
CCGTGCAATCGTCTACTCTATCGTCCTGCGAGAACAATCCCTACAATTGGTCCAAGGTGT
CTCCCAACCCCAACAACAGTCACAACAGCAACAAGTCGGACAATGTTCTTTCCAACAACC
TCAACCACAACAGGGTCAACAACAGCAAGTGCCACAGAGTGTTCTCTTGCAGCCACACCA
AATAGCTCAACTTGAGGCGACAACTTCCATTGCGCTGCGTACCCTACCAACGATGTGCAG
TGTTA



Homology of Contig U35_303 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None