Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_7621_PI390587928Hv_44K_v2TTCATCCATCTATTTTGCAGCAGCTAAACCCATGCAAGGTATTCCTCCAGCAACAGTGCA429GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0110.0130.1552.6236.5739.510
Raw 14.90728.005488.41911766.63710734.60717186.057



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_65457.12957e-2362 - 1219859 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00585 ABC00711 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_47363.14077e-23240 - 2999859 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_28499.13217e-233 - 629859 / 60plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_25576.13597e-2335 - 949859 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_75622.116513e-211353 - 14129758 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
MLOCMLOC_46003.113793e-2178 - 1379758 / 60plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
MLOCMLOC_6381.110353e-21598 - 6579758 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
JLOC1JLOC1_43078.12954e-2362 - 1219859 / 60minus
JLOC1JLOC1_30552.14074e-23240 - 2999859 / 60minus
JLOC1JLOC1_19111.13214e-233 - 629859 / 60plus
JLOC1JLOC1_17453.13284e-2335 - 949859 / 60minus
JLOC1JLOC1_50450.110842e-21786 - 8459758 / 60minus
JLOC1JLOC1_29821.18402e-2178 - 1379758 / 60plus
JLOC1JLOC1_29820.16022e-21466 - 5259758 / 60minus
JLOC1JLOC1_4154.110672e-21621 - 6809758 / 60minus
Harvest21ABC344377303e-25426 - 48510060 / 60plus
Harvest21ABC343026923e-25360 - 41910060 / 60plus
Harvest21ABC340336323e-2590 - 14910060 / 60plus
Harvest21ABC330426603e-25418 - 47710060 / 60plus
Harvest21ABC330223723e-25312 - 37110060 / 60plus
Harvest21ABC328325083e-25227 - 28610060 / 60plus
Harvest21ABC327365533e-25427 - 48610060 / 60plus
Harvest21ABC326526283e-25402 - 46110060 / 60plus
Harvest21ABC326004213e-25283 - 34210060 / 60plus
Harvest21ABC325125123e-25424 - 48310060 / 60plus
Harvest21ABC007749343e-25616 - 67510060 / 60plus
Harvest21ABC0052312353e-25555 - 61410060 / 60plusABC00523
Harvest21ABC003027133e-25288 - 34710060 / 60plus
Harvest21ABC002485473e-25403 - 46210060 / 60plus
Harvest21ABC002446203e-25406 - 46510060 / 60plus
Harvest21ABC529545571e-2371 - 1309859 / 60plus
Harvest21ABC527685621e-23449 - 5089859 / 60plus
Harvest21ABC527215601e-23435 - 4949859 / 60plus
Harvest21ABC452964541e-23303 - 3629859 / 60plus
Harvest21ABC450546611e-23384 - 4439859 / 60plus
Harvest21ABC438506001e-23257 - 3169859 / 60plus
Harvest21ABC437355711e-23137 - 1969859 / 60plus
Harvest21ABC437225791e-23489 - 5489859 / 60plus
Harvest21ABC435994571e-23304 - 3639859 / 60plus
Harvest21ABC435664821e-23344 - 4039859 / 60plus
Harvest21ABC435565121e-23228 - 2879859 / 60plus
Harvest21ABC434314341e-23342 - 4019859 / 60plus
Harvest21ABC344976611e-23429 - 4889859 / 60plus
Harvest21ABC344846761e-23138 - 1979859 / 60plus
Harvest21ABC343247111e-23284 - 3439859 / 60plus
Harvest21ABC342996781e-23173 - 2329859 / 60plus
Harvest21ABC341755831e-23521 - 5809859 / 60plus
Harvest21ABC331065281e-23390 - 4499859 / 60plus
Harvest21ABC329315221e-23248 - 3079859 / 60plus
Harvest21ABC329295511e-23400 - 4599859 / 60plus
Harvest21ABC328045411e-23360 - 4199859 / 60plus
Harvest21ABC322704681e-23183 - 2429859 / 60plus
Harvest21ABC298376811e-23304 - 3639859 / 60plus
Harvest21ABC289566051e-23311 - 3709859 / 60plus
Harvest21ABC008025251e-23403 - 4629859 / 60plus
Harvest21ABC007996811e-23334 - 3939859 / 60plus
Harvest21ABC0079310911e-23410 - 4699859 / 60plusABC00793
Harvest21ABC007916311e-23422 - 4819859 / 60plus
Harvest21ABC007838011e-23334 - 3939859 / 60plus
Harvest21ABC0078111721e-23491 - 5509859 / 60plus
Harvest21ABC007766001e-23264 - 3239859 / 60plus
Harvest21ABC007726621e-23380 - 4399859 / 60plus
Harvest21ABC007618321e-23512 - 5719859 / 60plus
Harvest21ABC007606371e-23320 - 3799859 / 60plus
Harvest21ABC007576051e-23174 - 2339859 / 60plus
Harvest21ABC007558741e-23597 - 6569859 / 60plus
Harvest21ABC0057710911e-23414 - 4739859 / 60plus
Harvest21ABC005745021e-23293 - 3529859 / 60plus
Harvest21ABC005636501e-23283 - 3429859 / 60plus
Harvest21ABC005525351e-23320 - 3799859 / 60plus
Harvest21ABC005498681e-23250 - 3099859 / 60plusABC00549
Harvest21ABC005409771e-23307 - 3669859 / 60plusABC00540
Harvest21ABC005345451e-23303 - 3629859 / 60plus
Harvest21ABC005317041e-23250 - 3099859 / 60plus
Harvest21ABC0053010961e-23430 - 4899859 / 60plusABC00530
Harvest21ABC005194831e-23396 - 4559859 / 60plus
Harvest21ABC005125431e-23413 - 4729859 / 60plus
Harvest21ABC0050612021e-23527 - 5869859 / 60plus
Harvest21ABC005056201e-23337 - 3969859 / 60plus
Harvest21ABC0050210711e-23405 - 4649859 / 60plusABC00502
Harvest21ABC0030510301e-23404 - 4639859 / 60plus
Harvest21ABC003044371e-23224 - 2839859 / 60plus
Harvest21ABC003019701e-23296 - 3559859 / 60plusABC00301
Harvest21ABC002896221e-23424 - 4839859 / 60plus
Harvest21ABC002876301e-23422 - 4819859 / 60plus
Harvest21ABC002836711e-23388 - 4479859 / 60plus
Harvest21ABC0025910111e-23341 - 4009859 / 60plus
Harvest21ABC002565911e-23383 - 4429859 / 60plus
Harvest21ABC002475801e-23397 - 4569859 / 60plus
Harvest21ABC002465971e-23401 - 4609859 / 60plus
Harvest21ABC0021115151e-23517 - 5769859 / 60plus
Harvest21ABC000225051e-23328 - 3879859 / 60plus
Harvest21ABC298296342e-22316 - 3739857 / 58plus
Harvest21ABC0076512402e-22624 - 6819857 / 58plusABC00765
Harvest21ABC530128686e-22246 - 3059758 / 60plusABC53012
Harvest21ABC529085786e-22377 - 4369758 / 60plus
Harvest21ABC529056726e-22242 - 3019758 / 60plus
Harvest21ABC528285306e-22203 - 2629758 / 60plus
Harvest21ABC528244276e-22255 - 3149758 / 60plus
Harvest21ABC528215636e-22329 - 3889758 / 60plus
Harvest21ABC527806686e-22353 - 4129758 / 60plus
Harvest21ABC527725976e-22353 - 4129758 / 60plus
Harvest21ABC527065896e-22260 - 3199758 / 60plus
Harvest21ABC527005486e-22403 - 4629758 / 60plus
Harvest21ABC482891066e-2226 - 859758 / 60plus
Harvest21ABC438732456e-22141 - 2009758 / 60plus
Harvest21ABC436276296e-22353 - 4129758 / 60plus
Harvest21ABC0081529006e-22958 - 10179758 / 60plusABC00815
Harvest21ABC008056716e-22317 - 3769758 / 60plus
Harvest21ABC007986316e-22343 - 4029758 / 60plus
Harvest21ABC007957856e-22449 - 5089758 / 60plus
Harvest21ABC0078910726e-22400 - 4599758 / 60plus
Harvest21ABC007859996e-22323 - 3829758 / 60plusABC00785
Harvest21ABC007637636e-22416 - 4759758 / 60plus
Harvest21ABC007626936e-22338 - 3979758 / 60plus
Harvest21ABC007598306e-22338 - 3979758 / 60plus
Harvest21ABC007548596e-22747 - 8069758 / 60plus
Harvest21ABC007516696e-22247 - 3069758 / 60plus
Harvest21ABC005859206e-22288 - 3479758 / 60plusABC00585
Harvest21ABC005626066e-22511 - 5709758 / 60plus
Harvest21ABC005599066e-22236 - 2959758 / 60plus
Harvest21ABC005486386e-22307 - 3669758 / 60plus
Harvest21ABC005298046e-22160 - 2199758 / 60plus
Harvest21ABC005286026e-22171 - 2309758 / 60plus
Harvest21ABC005085966e-22296 - 3559758 / 60plus
Harvest21ABC451733238e-21266 - 3239756 / 58plus
Harvest21ABC447154908e-21339 - 3969756 / 58plus
Harvest35U35_384577303e-25426 - 48510060 / 60plus
Harvest35U35_383606923e-25360 - 41910060 / 60plus
Harvest35U35_381766323e-2590 - 14910060 / 60plus
Harvest35U35_372806603e-25418 - 47710060 / 60plus
Harvest35U35_371595083e-25227 - 28610060 / 60plus
Harvest35U35_371025533e-25427 - 48610060 / 60plus
Harvest35U35_2245183e-25430 - 48910060 / 60plus
Harvest35U35_247293e-25304 - 36310060 / 60plus
Harvest35U35_506635571e-2371 - 1309859 / 60plus
Harvest35U35_505626371e-23380 - 4399859 / 60plus
Harvest35U35_505615621e-23449 - 5089859 / 60plus
Harvest35U35_505285601e-23435 - 4949859 / 60plus
Harvest35U35_452055711e-23137 - 1969859 / 60plus
Harvest35U35_451174821e-23344 - 4039859 / 60plus
Harvest35U35_451115121e-23228 - 2879859 / 60plus
Harvest35U35_385006611e-23429 - 4889859 / 60plus
Harvest35U35_383576781e-23173 - 2329859 / 60plus
Harvest35U35_373175281e-23390 - 4499859 / 60plus
Harvest35U35_372165221e-23248 - 3079859 / 60plus
Harvest35U35_372145511e-23400 - 4599859 / 60plus
Harvest35U35_371435411e-23360 - 4199859 / 60plus
Harvest35U35_296006051e-23311 - 3709859 / 60plus
Harvest35U35_3296171e-23403 - 4629859 / 60plus
Harvest35U35_3189771e-23439 - 4989859 / 60plus
Harvest35U35_3158781e-23747 - 8069859 / 60plus
Harvest35U35_31412351e-23645 - 7049859 / 60plus
Harvest35U35_3139341e-23264 - 3239859 / 60plus
Harvest35U35_3056371e-23320 - 3799859 / 60plus
Harvest35U35_3036051e-23174 - 2339859 / 60plus
Harvest35U35_30210801e-23747 - 8069859 / 60plus
Harvest35U35_2276611e-23384 - 4439859 / 60plus
Harvest35U35_2119841e-23307 - 3669859 / 60plus
Harvest35U35_2079051e-23302 - 3619859 / 60plus
Harvest35U35_2066021e-23259 - 3189859 / 60plus
Harvest35U35_2047061e-23250 - 3099859 / 60plus
Harvest35U35_2035831e-23430 - 4899859 / 60plus
Harvest35U35_19712061e-23527 - 5869859 / 60plus
Harvest35U35_1966851e-23338 - 3979859 / 60plus
Harvest35U35_1157111e-23284 - 3439859 / 60plus
Harvest35U35_1106331e-23424 - 4839859 / 60plus
Harvest35U35_1096301e-23422 - 4819859 / 60plus
Harvest35U35_1066711e-23388 - 4479859 / 60plus
Harvest35U35_1056491e-23587 - 6469859 / 60plus
Harvest35U35_887201e-23341 - 4009859 / 60plus
Harvest35U35_8210851e-23406 - 4659859 / 60plus
Harvest35U35_776331e-23407 - 4669859 / 60plus
Harvest35U35_689551e-23463 - 5229859 / 60plus
Harvest35U35_78281e-23482 - 5419859 / 60plus
Harvest35U35_236342e-22316 - 3739857 / 58plus
Harvest35U35_86782e-22386 - 4439857 / 58plus
Harvest35U35_506425786e-22377 - 4369758 / 60plus
Harvest35U35_505175486e-22403 - 4629758 / 60plus
Harvest35U35_451486296e-22353 - 4129758 / 60plus
Harvest35U35_33729006e-22958 - 10179758 / 60plus
Harvest35U35_3306716e-22317 - 3769758 / 60plus
Harvest35U35_3276316e-22343 - 4029758 / 60plus
Harvest35U35_32110896e-22400 - 4599758 / 60plus
Harvest35U35_3197246e-22323 - 3829758 / 60plus
Harvest35U35_31210466e-22616 - 6759758 / 60plus
Harvest35U35_3066936e-22338 - 3979758 / 60plus
Harvest35U35_3045776e-22338 - 3979758 / 60plus
Harvest35U35_3006696e-22247 - 3069758 / 60plus
Harvest35U35_2196086e-22511 - 5709758 / 60plus
Harvest35U35_2185996e-22236 - 2959758 / 60plus
Harvest35U35_2026526e-22160 - 2199758 / 60plus
Harvest35U35_1985986e-22296 - 3559758 / 60plus



Contig Sequence (518 bp)

>U35_224 518 Hv_44K_v2
GAAACACTAGTTAATACCAATCCACCATGAAGACCTTCCTCATCTTTGCACTCCTCGCCA
TTGTGGCAACAAGTACCATTGCACAGCAACAACCATACCCACAACAGCCCATCCCACAAC
AACCACAACCATACCCACAACAACCACAACCATTTTCACAACAGCCCATCCCACAACAAC
CACAACCATACCCACAACAACCACAACCATTTCCACAACAACCCATCCCACAACAACCAC
AACCATACCCACAACAACCACAACCATTTCCACAACAACCCTTCCCATCACAACAACCAT
TTCCGCAACAACCACCATTTTGGCAACAACAACCAATTCTATCGCAGCAACAACCATGTA
CACCACAACAAACACCACTCCCACAAGGACAACAAGATCAAATGCTTGTGCAAGTACAAA
TACCATTTGTTCATCCATCTATTTTGCAGCAGCTAAACCCATGCAAGGTATTCCTCCAGC
AACAGTGCAGCCCTGTGGCAATGTCACAACGTATTGCA



Homology of Contig U35_224 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None