Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_37060_PI390587928Hv_44K_v2AATGTTCAACCATCTATTTTGCAACAGCTAAACCCATGCAAGGTATTCCTCCAGCAGCAG743GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0170.0140.1822.8887.87012.731
Raw 17.09616.464290.9286598.9076515.05311690.097



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_22764.110836e-24581 - 63910059 / 59minus ABC00069 ABC00241 ABC00282 ABC00295 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC53012
MLOCMLOC_75622.116513e-221357 - 14159858 / 59minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
MLOCMLOC_46003.113793e-2275 - 1339858 / 59plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
MLOCMLOC_6381.110353e-22602 - 6609858 / 59minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
JLOC1JLOC1_15771.111313e-24629 - 68710059 / 59minus
JLOC1JLOC1_50450.110841e-22790 - 8489858 / 59minus
JLOC1JLOC1_29821.18401e-2275 - 1339858 / 59plus
JLOC1JLOC1_29820.16021e-22470 - 5289858 / 59minus
JLOC1JLOC1_4154.110671e-22625 - 6839858 / 59minus
Harvest21ABC289464813e-25364 - 42310060 / 60plus
Harvest21ABC0054310363e-25346 - 40510060 / 60plus
Harvest21ABC0028510083e-25321 - 38010060 / 60plus
Harvest21ABC450275401e-24216 - 27410059 / 59plus
Harvest21ABC434363821e-24312 - 37010059 / 59plus
Harvest21ABC342775731e-24372 - 43010059 / 59plus
Harvest21ABC329985471e-24197 - 25510059 / 59plus
Harvest21ABC328225701e-24282 - 34010059 / 59plus
Harvest21ABC326704501e-24164 - 22210059 / 59plus
Harvest21ABC324546841e-24344 - 40210059 / 59plus
Harvest21ABC0082214171e-24747 - 80510059 / 59plusABC00822
Harvest21ABC005826891e-24224 - 28210059 / 59plus
Harvest21ABC005248741e-24478 - 53610059 / 59plusABC00524
Harvest21ABC002968611e-24308 - 36610059 / 59plus
Harvest21ABC002926841e-24306 - 36410059 / 59plus
Harvest21ABC002697681e-24421 - 47910059 / 59plus
Harvest21ABC002648951e-24432 - 49010059 / 59plus
Harvest21ABC002435891e-24235 - 29310059 / 59plus
Harvest21ABC002407981e-24302 - 36010059 / 59plus
Harvest21ABC0023211321e-24462 - 52010059 / 59plus
Harvest21ABC002146981e-24295 - 35310059 / 59plus
Harvest21ABC530128685e-23243 - 3019858 / 59plusABC53012
Harvest21ABC529085785e-23374 - 4329858 / 59plus
Harvest21ABC529056725e-23239 - 2979858 / 59plus
Harvest21ABC528285305e-23200 - 2589858 / 59plus
Harvest21ABC528244275e-23252 - 3109858 / 59plus
Harvest21ABC528215635e-23326 - 3849858 / 59plus
Harvest21ABC527806685e-23350 - 4089858 / 59plus
Harvest21ABC527725975e-23350 - 4089858 / 59plus
Harvest21ABC527065895e-23257 - 3159858 / 59plus
Harvest21ABC527005485e-23400 - 4589858 / 59plus
Harvest21ABC451733235e-23263 - 3219858 / 59plus
Harvest21ABC438732455e-23138 - 1969858 / 59plus
Harvest21ABC436276295e-23350 - 4089858 / 59plus
Harvest21ABC0081529005e-23955 - 10139858 / 59plusABC00815
Harvest21ABC008056715e-23314 - 3729858 / 59plus
Harvest21ABC007986315e-23340 - 3989858 / 59plus
Harvest21ABC007957855e-23446 - 5049858 / 59plus
Harvest21ABC0078910725e-23397 - 4559858 / 59plus
Harvest21ABC007859995e-23320 - 3789858 / 59plusABC00785
Harvest21ABC007637635e-23413 - 4719858 / 59plus
Harvest21ABC007626935e-23335 - 3939858 / 59plus
Harvest21ABC007598305e-23335 - 3939858 / 59plus
Harvest21ABC007516695e-23244 - 3029858 / 59plus
Harvest21ABC005859205e-23285 - 3439858 / 59plusABC00585
Harvest21ABC005599065e-23233 - 2919858 / 59plus
Harvest21ABC005486385e-23304 - 3629858 / 59plus
Harvest21ABC005298045e-23157 - 2159858 / 59plus
Harvest21ABC005286025e-23168 - 2269858 / 59plus
Harvest21ABC005085965e-23293 - 3519858 / 59plus
Harvest21ABC529095392e-22332 - 3899857 / 58plus
Harvest21ABC527076452e-22190 - 2479857 / 58plus
Harvest21ABC330193242e-22267 - 3249857 / 58plus
Harvest21ABC0028211122e-22437 - 4949857 / 58plusABC00282
Harvest21ABC002665652e-22271 - 3289857 / 58plus
Harvest21ABC0024111192e-22439 - 4969857 / 58plusABC00241
Harvest21ABC000699632e-22284 - 3419857 / 58plusABC00069
Harvest21ABC005609716e-22316 - 3729856 / 57plus
Harvest21ABC447154902e-21334 - 3929757 / 59plus
Harvest21ABC344616332e-21230 - 2889757 / 59plus
Harvest21ABC341595482e-21260 - 3189757 / 59plus
Harvest21ABC341377022e-21362 - 4209757 / 59plus
Harvest21ABC340566202e-21336 - 3949757 / 59plus
Harvest21ABC331104912e-21217 - 2759757 / 59plus
Harvest21ABC324525882e-21418 - 4769757 / 59plus
Harvest21ABC324467472e-21689 - 7479757 / 59plus
Harvest21ABC322925822e-21294 - 3529757 / 59plus
Harvest21ABC0081814112e-21691 - 7499757 / 59plus
Harvest21ABC002585972e-21247 - 3059757 / 59plus
Harvest21ABC002527012e-21375 - 4339757 / 59plus
Harvest21ABC529545578e-2169 - 1269756 / 58plus
Harvest21ABC527685628e-21447 - 5049756 / 58plus
Harvest21ABC527215608e-21433 - 4909756 / 58plus
Harvest21ABC452964548e-21301 - 3589756 / 58plus
Harvest21ABC450546618e-21382 - 4399756 / 58plus
Harvest21ABC438506008e-21255 - 3129756 / 58plus
Harvest21ABC437355718e-21135 - 1929756 / 58plus
Harvest21ABC437225798e-21487 - 5449756 / 58plus
Harvest21ABC435994578e-21302 - 3599756 / 58plus
Harvest21ABC435664828e-21342 - 3999756 / 58plus
Harvest21ABC435565128e-21226 - 2839756 / 58plus
Harvest21ABC434314348e-21340 - 3979756 / 58plus
Harvest21ABC344976618e-21427 - 4849756 / 58plus
Harvest21ABC344846768e-21136 - 1939756 / 58plus
Harvest21ABC343247118e-21282 - 3399756 / 58plus
Harvest21ABC342996788e-21171 - 2289756 / 58plus
Harvest21ABC341755838e-21519 - 5769756 / 58plus
Harvest21ABC331065288e-21388 - 4459756 / 58plus
Harvest21ABC329315228e-21246 - 3039756 / 58plus
Harvest21ABC329295518e-21398 - 4559756 / 58plus
Harvest21ABC328045418e-21358 - 4159756 / 58plus
Harvest21ABC322704688e-21181 - 2389756 / 58plus
Harvest21ABC298376818e-21302 - 3599756 / 58plus
Harvest21ABC298296348e-21314 - 3719756 / 58plus
Harvest21ABC289566058e-21309 - 3669756 / 58plus
Harvest21ABC008025258e-21401 - 4589756 / 58plus
Harvest21ABC007996818e-21332 - 3899756 / 58plus
Harvest21ABC0079310918e-21408 - 4659756 / 58plusABC00793
Harvest21ABC007916318e-21420 - 4779756 / 58plus
Harvest21ABC007838018e-21332 - 3899756 / 58plus
Harvest21ABC0078111728e-21489 - 5469756 / 58plus
Harvest21ABC007766008e-21262 - 3199756 / 58plus
Harvest21ABC007726628e-21378 - 4359756 / 58plus
Harvest21ABC0076512408e-21622 - 6799756 / 58plusABC00765
Harvest21ABC007618328e-21510 - 5679756 / 58plus
Harvest21ABC007606378e-21318 - 3759756 / 58plus
Harvest21ABC007576058e-21172 - 2299756 / 58plus
Harvest21ABC007558748e-21595 - 6529756 / 58plus
Harvest21ABC0057710918e-21412 - 4699756 / 58plus
Harvest21ABC005745028e-21291 - 3489756 / 58plus
Harvest21ABC005636508e-21281 - 3389756 / 58plus
Harvest21ABC005525358e-21318 - 3759756 / 58plus
Harvest21ABC005498688e-21248 - 3059756 / 58plusABC00549
Harvest21ABC005409778e-21305 - 3629756 / 58plusABC00540
Harvest21ABC005345458e-21301 - 3589756 / 58plus
Harvest21ABC005317048e-21248 - 3059756 / 58plus
Harvest21ABC0053010968e-21428 - 4859756 / 58plusABC00530
Harvest21ABC005194838e-21394 - 4519756 / 58plus
Harvest21ABC005125438e-21411 - 4689756 / 58plus
Harvest21ABC0050612028e-21525 - 5829756 / 58plus
Harvest21ABC005056208e-21335 - 3929756 / 58plus
Harvest21ABC0050210718e-21403 - 4609756 / 58plusABC00502
Harvest21ABC0030510308e-21402 - 4599756 / 58plus
Harvest21ABC003044378e-21222 - 2799756 / 58plus
Harvest21ABC003019708e-21294 - 3519756 / 58plusABC00301
Harvest21ABC002896228e-21422 - 4799756 / 58plus
Harvest21ABC002876308e-21420 - 4779756 / 58plus
Harvest21ABC002836718e-21386 - 4439756 / 58plus
Harvest21ABC0025910118e-21339 - 3969756 / 58plus
Harvest21ABC002565918e-21381 - 4389756 / 58plus
Harvest21ABC002475808e-21395 - 4529756 / 58plus
Harvest21ABC002465978e-21399 - 4569756 / 58plus
Harvest21ABC0021115158e-21515 - 5729756 / 58plus
Harvest21ABC000225058e-21326 - 3839756 / 58plus
Harvest35U35_98613e-25744 - 80310060 / 60plus
Harvest35U35_381696081e-24322 - 38010059 / 59plus
Harvest35U35_372565471e-24197 - 25510059 / 59plus
Harvest35U35_371555701e-24282 - 34010059 / 59plus
Harvest35U35_34214171e-24747 - 80510059 / 59plus
Harvest35U35_2266911e-24224 - 28210059 / 59plus
Harvest35U35_1149741e-24306 - 36410059 / 59plus
Harvest35U35_815891e-24235 - 29310059 / 59plus
Harvest35U35_784881e-24302 - 36010059 / 59plus
Harvest35U35_7511411e-24459 - 51710059 / 59plus
Harvest35U35_506425785e-23374 - 4329858 / 59plus
Harvest35U35_505175485e-23400 - 4589858 / 59plus
Harvest35U35_451486295e-23350 - 4089858 / 59plus
Harvest35U35_33729005e-23955 - 10139858 / 59plus
Harvest35U35_3306715e-23314 - 3729858 / 59plus
Harvest35U35_3276315e-23340 - 3989858 / 59plus
Harvest35U35_32110895e-23397 - 4559858 / 59plus
Harvest35U35_3197245e-23320 - 3789858 / 59plus
Harvest35U35_31210465e-23613 - 6719858 / 59plus
Harvest35U35_3066935e-23335 - 3939858 / 59plus
Harvest35U35_3045775e-23335 - 3939858 / 59plus
Harvest35U35_3006695e-23244 - 3029858 / 59plus
Harvest35U35_2185995e-23233 - 2919858 / 59plus
Harvest35U35_2026525e-23157 - 2159858 / 59plus
Harvest35U35_1985985e-23293 - 3519858 / 59plus
Harvest35U35_905652e-22271 - 3289857 / 58plus
Harvest35U35_7911202e-22439 - 4969857 / 58plus
Harvest35U35_259392e-22284 - 3419857 / 58plus
Harvest35U35_384776332e-21230 - 2889757 / 59plus
Harvest35U35_382497022e-21362 - 4209757 / 59plus
Harvest35U35_381946202e-21336 - 3949757 / 59plus
Harvest35U35_369387472e-21689 - 7479757 / 59plus
Harvest35U35_33913792e-21691 - 7499757 / 59plus
Harvest35U35_2136382e-21303 - 3619757 / 59plus
Harvest35U35_876022e-21252 - 3109757 / 59plus
Harvest35U35_847012e-21375 - 4339757 / 59plus
Harvest35U35_506635578e-2169 - 1269756 / 58plus
Harvest35U35_505626378e-21378 - 4359756 / 58plus
Harvest35U35_505615628e-21447 - 5049756 / 58plus
Harvest35U35_505285608e-21433 - 4909756 / 58plus
Harvest35U35_452055718e-21135 - 1929756 / 58plus
Harvest35U35_451174828e-21342 - 3999756 / 58plus
Harvest35U35_451115128e-21226 - 2839756 / 58plus
Harvest35U35_385006618e-21427 - 4849756 / 58plus
Harvest35U35_383576788e-21171 - 2289756 / 58plus
Harvest35U35_373175288e-21388 - 4459756 / 58plus
Harvest35U35_372165228e-21246 - 3039756 / 58plus
Harvest35U35_372145518e-21398 - 4559756 / 58plus
Harvest35U35_371435418e-21358 - 4159756 / 58plus
Harvest35U35_296006058e-21309 - 3669756 / 58plus
Harvest35U35_3296178e-21401 - 4589756 / 58plus
Harvest35U35_3189778e-21437 - 4949756 / 58plus
Harvest35U35_3158788e-21745 - 8029756 / 58plus
Harvest35U35_31412358e-21643 - 7009756 / 58plus
Harvest35U35_3139348e-21262 - 3199756 / 58plus
Harvest35U35_3056378e-21318 - 3759756 / 58plus
Harvest35U35_3036058e-21172 - 2299756 / 58plus
Harvest35U35_30210808e-21745 - 8029756 / 58plus
Harvest35U35_2276618e-21382 - 4399756 / 58plus
Harvest35U35_2119848e-21305 - 3629756 / 58plus
Harvest35U35_2079058e-21300 - 3579756 / 58plus
Harvest35U35_2066028e-21257 - 3149756 / 58plus
Harvest35U35_2047068e-21248 - 3059756 / 58plus
Harvest35U35_2035838e-21428 - 4859756 / 58plus
Harvest35U35_19712068e-21525 - 5829756 / 58plus
Harvest35U35_1966858e-21336 - 3939756 / 58plus
Harvest35U35_1157118e-21282 - 3399756 / 58plus
Harvest35U35_1106338e-21422 - 4799756 / 58plus
Harvest35U35_1096308e-21420 - 4779756 / 58plus
Harvest35U35_1066718e-21386 - 4439756 / 58plus
Harvest35U35_1056498e-21585 - 6429756 / 58plus
Harvest35U35_887208e-21339 - 3969756 / 58plus
Harvest35U35_8210858e-21404 - 4619756 / 58plus
Harvest35U35_776338e-21405 - 4629756 / 58plus
Harvest35U35_689558e-21461 - 5189756 / 58plus
Harvest35U35_236348e-21314 - 3719756 / 58plus
Harvest35U35_86788e-21384 - 4419756 / 58plus
Harvest35U35_78288e-21480 - 5379756 / 58plus



Contig Sequence (861 bp)

>U35_9 861 Hv_44K_v2
GAGAACCAACCCCAGTATAAGTAAACACACCATCACACCCTTGAGGCCCATGGCTGGTTG
GCTGTCTCACACACCAAGATCAGAAACATCAATTCCAAGAAAGCAATAGTAACCACAAAT
CCAACATGAAGACCTTCCTCACCTTTGTCCTCCTTGCCATGGTGATGAGCATCGTCACTA
CCGCTAGGCAACTAAACCCTAGCAGCCAAGAGTTGCAATCACCACAACAATCATATCTGC
AGCAGCCATATCCACAAAACCCATATCTACCGCAACAACTATTTCCAGTGCAGCAACCGT
TTCACACACCCCAACAATATTTCCCCTATCTACCAGAGGAATTGTTTCCCCAATATCAAA
TACCAACCCCCCTACAACCACAACAACCTCTTCCTCGGCCCCAAAAACCATTCCCCTGGC
AACCACAACAACCATTTCCCCAGCCCCAAGAACCAATTCCCCAACAACAACAACAACAAC
GGCAACAGCAACAGCAACAACCATTCCCCCAGCAACCACAACAACCTTTTCCTCAGCCAC
AACAACCATTCCCCTCGCAACCACAACAACCATTTCCCCAGCCCCAACAACCAATTCCCT
ACCAACCACAACAACCATTTCCACAGCAACCACCATTTGGGCTACAACAACCAATTCTAT
CGCAACAACAACCATGTACACCACAACAAACACCACTCCCACAAGGACAACTGTACCAAA
CGCTTCTGCAACTACAAATACCCAATGTTCAACCATCTATTTTGCAACAGCTAAACCCAT
GCAAGGTATTCCTCCAGCAGCAGTGCAGCCCCGTGCGAATGCAACAACTTATTGCTAGGT
CGCAAATGTTGCAGCAGAGCA



Homology of Contig U35_9 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None