Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_34191_PI390587928Hv_44K_v2AACGTATTGCAAGGTCGCAAATGTTGCAACAGAGCAGTTGCCATGTGTTGCAGCAACAAT467GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0120.0130.1712.7206.2119.355
Raw 19.03127.491504.89711440.2539561.03715769.003



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_28499.13212e-2481 - 14010060 / 60plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_47363.14077e-23162 - 2219859 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_27672.12367e-2311 - 709859 / 60plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_75622.116513e-211275 - 13349758 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
JLOC1JLOC1_19111.13218e-2581 - 14010060 / 60plus
JLOC1JLOC1_30552.14074e-23162 - 2219859 / 60minus
JLOC1JLOC1_18660.12364e-2311 - 709859 / 60plus
JLOC1JLOC1_50450.110842e-21708 - 7679758 / 60minus
Harvest21ABC452964543e-25381 - 44010060 / 60plus
Harvest21ABC450546613e-25462 - 52110060 / 60plus
Harvest21ABC438506003e-25335 - 39410060 / 60plus
Harvest21ABC438381973e-25137 - 19610060 / 60plus
Harvest21ABC435994573e-25382 - 44110060 / 60plus
Harvest21ABC435664823e-25422 - 48110060 / 60plus
Harvest21ABC435565123e-25306 - 36510060 / 60plus
Harvest21ABC344846763e-25216 - 27510060 / 60plus
Harvest21ABC344377303e-25504 - 56310060 / 60plus
Harvest21ABC343247113e-25362 - 42110060 / 60plus
Harvest21ABC343026923e-25438 - 49710060 / 60plus
Harvest21ABC342996783e-25251 - 31010060 / 60plus
Harvest21ABC340336323e-25168 - 22710060 / 60plus
Harvest21ABC331065283e-25468 - 52710060 / 60plus
Harvest21ABC330426603e-25496 - 55510060 / 60plus
Harvest21ABC329315223e-25326 - 38510060 / 60plus
Harvest21ABC329295513e-25478 - 53710060 / 60plus
Harvest21ABC328325083e-25305 - 36410060 / 60plus
Harvest21ABC328045413e-25438 - 49710060 / 60plus
Harvest21ABC326526283e-25480 - 53910060 / 60plus
Harvest21ABC322704683e-25261 - 32010060 / 60plus
Harvest21ABC298376813e-25382 - 44110060 / 60plus
Harvest21ABC0078111723e-25569 - 62810060 / 60plus
Harvest21ABC007618323e-25590 - 64910060 / 60plus
Harvest21ABC005745023e-25371 - 43010060 / 60plus
Harvest21ABC005345453e-25381 - 44010060 / 60plus
Harvest21ABC005317043e-25328 - 38710060 / 60plus
Harvest21ABC0053010963e-25508 - 56710060 / 60plusABC00530
Harvest21ABC0052312353e-25633 - 69210060 / 60plusABC00523
Harvest21ABC0050612023e-25605 - 66410060 / 60plus
Harvest21ABC005056203e-25415 - 47410060 / 60plus
Harvest21ABC003044373e-25302 - 36110060 / 60plus
Harvest21ABC003027133e-25366 - 42510060 / 60plus
Harvest21ABC003019703e-25374 - 43310060 / 60plusABC00301
Harvest21ABC002876303e-25500 - 55910060 / 60plus
Harvest21ABC002836713e-25466 - 52510060 / 60plus
Harvest21ABC0025910113e-25419 - 47810060 / 60plus
Harvest21ABC002565913e-25461 - 52010060 / 60plus
Harvest21ABC002475803e-25475 - 53410060 / 60plus
Harvest21ABC002446203e-25484 - 54310060 / 60plus
Harvest21ABC0021115153e-25595 - 65410060 / 60plus
Harvest21ABC000225053e-25406 - 46510060 / 60plus
Harvest21ABC326004214e-24361 - 4209859 / 60plus
Harvest21ABC007726624e-24458 - 51510058 / 58plus
Harvest21ABC002485474e-24481 - 5409859 / 60plus
Harvest21ABC298296341e-23394 - 4539859 / 60plus
Harvest21ABC289566051e-23389 - 4489859 / 60plus
Harvest21ABC0076512401e-23702 - 7619859 / 60plusABC00765
Harvest21ABC0057710911e-23492 - 5519859 / 60plus
Harvest21ABC005636501e-23361 - 4209859 / 60plus
Harvest21ABC005525351e-23398 - 4579859 / 60plus
Harvest21ABC005498681e-23328 - 3879859 / 60plusABC00549
Harvest21ABC005409771e-23385 - 4449859 / 60plusABC00540
Harvest21ABC002896221e-23502 - 5619859 / 60plus
Harvest21ABC002465971e-23479 - 5389859 / 60plus
Harvest21ABC529003582e-22253 - 3109857 / 58plus
Harvest21ABC344976612e-22507 - 5649857 / 58plus
Harvest21ABC007996812e-22412 - 4699857 / 58plus
Harvest21ABC0079310912e-22488 - 5459857 / 58plusABC00793
Harvest21ABC007916312e-22500 - 5579857 / 58plus
Harvest21ABC007838012e-22412 - 4699857 / 58plus
Harvest21ABC007606372e-22398 - 4559857 / 58plus
Harvest21ABC007576052e-22252 - 3099857 / 58plus
Harvest21ABC007558742e-22675 - 7329857 / 58plus
Harvest21ABC0030510302e-22482 - 5399857 / 58plus
Harvest21ABC530128686e-22324 - 3839758 / 60plusABC53012
Harvest21ABC529545576e-22149 - 2089758 / 60plus
Harvest21ABC452713296e-22239 - 2989758 / 60plus
Harvest21ABC447154906e-22415 - 4749758 / 60plus
Harvest21ABC437355716e-22215 - 2749758 / 60plus
Harvest21ABC0081529006e-221036 - 10959758 / 60plusABC00815
Harvest21ABC007766006e-22342 - 4019758 / 60plus
Harvest21ABC005609716e-22397 - 4569758 / 60plus
Harvest21ABC005298046e-22238 - 2979758 / 60plus
Harvest21ABC005286026e-22249 - 3089758 / 60plus
Harvest21ABC005085966e-22374 - 4339758 / 60plus
Harvest21ABC0050210716e-22483 - 5429758 / 60plusABC00502
Harvest35U35_451174823e-25422 - 48110060 / 60plus
Harvest35U35_451115123e-25306 - 36510060 / 60plus
Harvest35U35_384577303e-25504 - 56310060 / 60plus
Harvest35U35_383606923e-25438 - 49710060 / 60plus
Harvest35U35_383576783e-25251 - 31010060 / 60plus
Harvest35U35_381766323e-25168 - 22710060 / 60plus
Harvest35U35_373175283e-25468 - 52710060 / 60plus
Harvest35U35_372806603e-25496 - 55510060 / 60plus
Harvest35U35_372165223e-25326 - 38510060 / 60plus
Harvest35U35_372145513e-25478 - 53710060 / 60plus
Harvest35U35_371595083e-25305 - 36410060 / 60plus
Harvest35U35_371435413e-25438 - 49710060 / 60plus
Harvest35U35_3296173e-25481 - 54010060 / 60plus
Harvest35U35_3189773e-25517 - 57610060 / 60plus
Harvest35U35_2276613e-25462 - 52110060 / 60plus
Harvest35U35_2079053e-25380 - 43910060 / 60plus
Harvest35U35_2066023e-25337 - 39610060 / 60plus
Harvest35U35_2035833e-25508 - 56710060 / 60plus
Harvest35U35_19712063e-25605 - 66410060 / 60plus
Harvest35U35_1966853e-25416 - 47510060 / 60plus
Harvest35U35_1096303e-25500 - 55910060 / 60plus
Harvest35U35_1066713e-25466 - 52510060 / 60plus
Harvest35U35_887203e-25419 - 47810060 / 60plus
Harvest35U35_776333e-25485 - 54410060 / 60plus
Harvest35U35_689553e-25541 - 60010060 / 60plus
Harvest35U35_247293e-25382 - 44110060 / 60plus
Harvest35U35_296006051e-23389 - 4489859 / 60plus
Harvest35U35_30210801e-23825 - 8849859 / 60plus
Harvest35U35_2119841e-23385 - 4449859 / 60plus
Harvest35U35_2047061e-23328 - 3879859 / 60plus
Harvest35U35_1157111e-23362 - 4219859 / 60plus
Harvest35U35_8210851e-23484 - 5439859 / 60plus
Harvest35U35_236341e-23394 - 4539859 / 60plus
Harvest35U35_86781e-23464 - 5239859 / 60plus
Harvest35U35_505626372e-22458 - 5159857 / 58plus
Harvest35U35_385006612e-22507 - 5649857 / 58plus
Harvest35U35_31412352e-22723 - 7809857 / 58plus
Harvest35U35_3056372e-22398 - 4559857 / 58plus
Harvest35U35_3036052e-22252 - 3099857 / 58plus
Harvest35U35_1106332e-22502 - 5599857 / 58plus
Harvest35U35_78282e-22560 - 6179857 / 58plus
Harvest35U35_506635576e-22149 - 2089758 / 60plus
Harvest35U35_452055716e-22215 - 2749758 / 60plus
Harvest35U35_33729006e-221036 - 10959758 / 60plus
Harvest35U35_3139346e-22342 - 4019758 / 60plus
Harvest35U35_2026526e-22238 - 2979758 / 60plus
Harvest35U35_1985986e-22374 - 4339758 / 60plus



Contig Sequence (528 bp)

>U35_37317 528 Hv_44K_v2
GAGATCAAAACCAAGAAACACTAGTTAATACCAATCCACCATGAAGACCTTCCTCATCTT
TGCACTCCTCGCCATTGTGGCAACAAGTACCATTGCACAGCAACAACCATACCCACAACA
ACCACAACCATTTCCACAACAACCCATCCCACAACAACCACAACCATACCCACAACAACC
ACAACCATTTCCACAACAGCCCATCCCACAACAACCACAACCATACCCACAACAACCACA
ACCATTTTCACAACAACCATTTCCGCAACAACCACCATTTTGGCAACAACAACCAATTCT
ATCGCAGCAACAACCATGTACACCACAACAAACACCACTCCCACAAGGACAACAAGATCA
AATGCTTGTGCAAGTACAAATACCATTTGTTCATCCATCTATTTTGCAGCAGCTAAACCC
ATGCAAGGTATTCCTCCAGCAGCAGTGCAGCCCTGTGGCAATGTCACAACGTATTGCAAG
GTCGCAAATGTTGCAACAGAGCAGTTGCCATGTGTTGCAGCAACAATG



Homology of Contig U35_37317 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None