Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_32236_PI390587928Hv_44K_v2TTGTTCATCCATCTATTTTGCAGCAGCTAAACCCATGCAAGGTATTCCTCCAGCAGCAGT445GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0120.0120.1512.5296.0168.934
Raw 16.08824.774488.69511719.87710075.83716505.280



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_65457.12952e-2465 - 12410060 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00585 ABC00711 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_47363.14072e-24243 - 30210060 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_25576.13592e-2438 - 9710060 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_28499.13216e-241 - 5910059 / 59plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_75622.116513e-221356 - 14149858 / 59minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
MLOCMLOC_46003.113793e-2276 - 1349858 / 59plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
MLOCMLOC_6381.110353e-22601 - 6599858 / 59minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
JLOC1JLOC1_43078.12958e-2565 - 12410060 / 60minus
JLOC1JLOC1_30552.14078e-25243 - 30210060 / 60minus
JLOC1JLOC1_17453.13288e-2538 - 9710060 / 60minus
JLOC1JLOC1_19111.13213e-241 - 5910059 / 59plus
JLOC1JLOC1_50450.110841e-22789 - 8479858 / 59minus
JLOC1JLOC1_29821.18401e-2276 - 1349858 / 59plus
JLOC1JLOC1_29820.16021e-22469 - 5279858 / 59minus
JLOC1JLOC1_4154.110671e-22624 - 6829858 / 59minus
JLOC1JLOC1_15771.111316e-21628 - 6869757 / 59minus
Harvest21ABC529545573e-2568 - 12710060 / 60plus
Harvest21ABC527685623e-25446 - 50510060 / 60plus
Harvest21ABC527215603e-25432 - 49110060 / 60plus
Harvest21ABC452964543e-25300 - 35910060 / 60plus
Harvest21ABC450546613e-25381 - 44010060 / 60plus
Harvest21ABC438506003e-25254 - 31310060 / 60plus
Harvest21ABC437355713e-25134 - 19310060 / 60plus
Harvest21ABC437225793e-25486 - 54510060 / 60plus
Harvest21ABC435994573e-25301 - 36010060 / 60plus
Harvest21ABC435664823e-25341 - 40010060 / 60plus
Harvest21ABC435565123e-25225 - 28410060 / 60plus
Harvest21ABC434314343e-25339 - 39810060 / 60plus
Harvest21ABC344976613e-25426 - 48510060 / 60plus
Harvest21ABC344846763e-25135 - 19410060 / 60plus
Harvest21ABC343247113e-25281 - 34010060 / 60plus
Harvest21ABC342996783e-25170 - 22910060 / 60plus
Harvest21ABC341755833e-25518 - 57710060 / 60plus
Harvest21ABC331065283e-25387 - 44610060 / 60plus
Harvest21ABC329315223e-25245 - 30410060 / 60plus
Harvest21ABC329295513e-25397 - 45610060 / 60plus
Harvest21ABC328045413e-25357 - 41610060 / 60plus
Harvest21ABC322704683e-25180 - 23910060 / 60plus
Harvest21ABC298376813e-25301 - 36010060 / 60plus
Harvest21ABC298296343e-25313 - 37210060 / 60plus
Harvest21ABC289566053e-25308 - 36710060 / 60plus
Harvest21ABC008025253e-25400 - 45910060 / 60plus
Harvest21ABC007996813e-25331 - 39010060 / 60plus
Harvest21ABC0079310913e-25407 - 46610060 / 60plusABC00793
Harvest21ABC007916313e-25419 - 47810060 / 60plus
Harvest21ABC007838013e-25331 - 39010060 / 60plus
Harvest21ABC0078111723e-25488 - 54710060 / 60plus
Harvest21ABC007766003e-25261 - 32010060 / 60plus
Harvest21ABC007726623e-25377 - 43610060 / 60plus
Harvest21ABC0076512403e-25621 - 68010060 / 60plusABC00765
Harvest21ABC007618323e-25509 - 56810060 / 60plus
Harvest21ABC007606373e-25317 - 37610060 / 60plus
Harvest21ABC007576053e-25171 - 23010060 / 60plus
Harvest21ABC007558743e-25594 - 65310060 / 60plus
Harvest21ABC0057710913e-25411 - 47010060 / 60plus
Harvest21ABC005745023e-25290 - 34910060 / 60plus
Harvest21ABC005636503e-25280 - 33910060 / 60plus
Harvest21ABC005525353e-25317 - 37610060 / 60plus
Harvest21ABC005498683e-25247 - 30610060 / 60plusABC00549
Harvest21ABC005409773e-25304 - 36310060 / 60plusABC00540
Harvest21ABC005345453e-25300 - 35910060 / 60plus
Harvest21ABC005317043e-25247 - 30610060 / 60plus
Harvest21ABC0053010963e-25427 - 48610060 / 60plusABC00530
Harvest21ABC005194833e-25393 - 45210060 / 60plus
Harvest21ABC005125433e-25410 - 46910060 / 60plus
Harvest21ABC0050612023e-25524 - 58310060 / 60plus
Harvest21ABC005056203e-25334 - 39310060 / 60plus
Harvest21ABC0050210713e-25402 - 46110060 / 60plusABC00502
Harvest21ABC0030510303e-25401 - 46010060 / 60plus
Harvest21ABC003044373e-25221 - 28010060 / 60plus
Harvest21ABC003019703e-25293 - 35210060 / 60plusABC00301
Harvest21ABC002896223e-25421 - 48010060 / 60plus
Harvest21ABC002876303e-25419 - 47810060 / 60plus
Harvest21ABC002836713e-25385 - 44410060 / 60plus
Harvest21ABC0025910113e-25338 - 39710060 / 60plus
Harvest21ABC002565913e-25380 - 43910060 / 60plus
Harvest21ABC002475803e-25394 - 45310060 / 60plus
Harvest21ABC002465973e-25398 - 45710060 / 60plus
Harvest21ABC0021115153e-25514 - 57310060 / 60plus
Harvest21ABC000225053e-25325 - 38410060 / 60plus
Harvest21ABC344377301e-23423 - 4829859 / 60plus
Harvest21ABC343026921e-23357 - 4169859 / 60plus
Harvest21ABC340336321e-2387 - 1469859 / 60plus
Harvest21ABC330426601e-23415 - 4749859 / 60plus
Harvest21ABC330223721e-23309 - 3689859 / 60plus
Harvest21ABC327365531e-23424 - 4839859 / 60plus
Harvest21ABC326526281e-23399 - 4589859 / 60plus
Harvest21ABC325125121e-23421 - 4809859 / 60plus
Harvest21ABC007749341e-23613 - 6729859 / 60plus
Harvest21ABC007548591e-23744 - 8039859 / 60plus
Harvest21ABC005626061e-23508 - 5679859 / 60plus
Harvest21ABC0052312351e-23552 - 6119859 / 60plusABC00523
Harvest21ABC003027131e-23285 - 3449859 / 60plus
Harvest21ABC002485471e-23400 - 4599859 / 60plus
Harvest21ABC002446201e-23403 - 4629859 / 60plus
Harvest21ABC530128685e-23244 - 3029858 / 59plusABC53012
Harvest21ABC529085785e-23375 - 4339858 / 59plus
Harvest21ABC529056725e-23240 - 2989858 / 59plus
Harvest21ABC528285305e-23201 - 2599858 / 59plus
Harvest21ABC528244275e-23253 - 3119858 / 59plus
Harvest21ABC528215635e-23327 - 3859858 / 59plus
Harvest21ABC527806685e-23351 - 4099858 / 59plus
Harvest21ABC527725975e-23351 - 4099858 / 59plus
Harvest21ABC527065895e-23258 - 3169858 / 59plus
Harvest21ABC527005485e-23401 - 4599858 / 59plus
Harvest21ABC451733235e-23264 - 3229858 / 59plus
Harvest21ABC438732455e-23139 - 1979858 / 59plus
Harvest21ABC436276295e-23351 - 4099858 / 59plus
Harvest21ABC0081529005e-23956 - 10149858 / 59plusABC00815
Harvest21ABC008056715e-23315 - 3739858 / 59plus
Harvest21ABC007986315e-23341 - 3999858 / 59plus
Harvest21ABC007957855e-23447 - 5059858 / 59plus
Harvest21ABC0078910725e-23398 - 4569858 / 59plus
Harvest21ABC007859995e-23321 - 3799858 / 59plusABC00785
Harvest21ABC007637635e-23414 - 4729858 / 59plus
Harvest21ABC007626935e-23336 - 3949858 / 59plus
Harvest21ABC007598305e-23336 - 3949858 / 59plus
Harvest21ABC007516695e-23245 - 3039858 / 59plus
Harvest21ABC005859205e-23286 - 3449858 / 59plusABC00585
Harvest21ABC005599065e-23234 - 2929858 / 59plus
Harvest21ABC005486385e-23305 - 3639858 / 59plus
Harvest21ABC005298045e-23158 - 2169858 / 59plus
Harvest21ABC005286025e-23169 - 2279858 / 59plus
Harvest21ABC005085965e-23294 - 3529858 / 59plus
Harvest21ABC328325082e-22226 - 2839857 / 58plus
Harvest21ABC326004212e-22282 - 3399857 / 58plus
Harvest21ABC529095396e-22333 - 3899856 / 57plus
Harvest21ABC527076456e-22191 - 2479856 / 57plus
Harvest21ABC0028211126e-22438 - 4949856 / 57plusABC00282
Harvest21ABC002665656e-22272 - 3289856 / 57plus
Harvest21ABC0024111196e-22440 - 4969856 / 57plusABC00241
Harvest21ABC000699636e-22285 - 3419856 / 57plusABC00069
Harvest21ABC482891062e-2123 - 819757 / 59plus
Harvest21ABC450275402e-21217 - 2759757 / 59plus
Harvest21ABC447154902e-21335 - 3939757 / 59plus
Harvest21ABC434363822e-21313 - 3719757 / 59plus
Harvest21ABC344616332e-21231 - 2899757 / 59plus
Harvest21ABC342775732e-21373 - 4319757 / 59plus
Harvest21ABC341595482e-21261 - 3199757 / 59plus
Harvest21ABC341377022e-21363 - 4219757 / 59plus
Harvest21ABC340566202e-21337 - 3959757 / 59plus
Harvest21ABC331104912e-21218 - 2769757 / 59plus
Harvest21ABC329985472e-21198 - 2569757 / 59plus
Harvest21ABC328225702e-21283 - 3419757 / 59plus
Harvest21ABC326704502e-21165 - 2239757 / 59plus
Harvest21ABC324546842e-21345 - 4039757 / 59plus
Harvest21ABC324525882e-21419 - 4779757 / 59plus
Harvest21ABC322925822e-21295 - 3539757 / 59plus
Harvest21ABC289464812e-21366 - 4249757 / 59plus
Harvest21ABC0082214172e-21748 - 8069757 / 59plusABC00822
Harvest21ABC0081814112e-21692 - 7509757 / 59plus
Harvest21ABC005826892e-21225 - 2839757 / 59plus
Harvest21ABC005609712e-21317 - 3729855 / 56plus
Harvest21ABC0054310362e-21348 - 4069757 / 59plus
Harvest21ABC005248742e-21479 - 5379757 / 59plusABC00524
Harvest21ABC002968612e-21309 - 3679757 / 59plus
Harvest21ABC002926842e-21307 - 3659757 / 59plus
Harvest21ABC0028510082e-21323 - 3819757 / 59plus
Harvest21ABC002697682e-21422 - 4809757 / 59plus
Harvest21ABC002648952e-21433 - 4919757 / 59plus
Harvest21ABC002585972e-21248 - 3069757 / 59plus
Harvest21ABC002527012e-21376 - 4349757 / 59plus
Harvest21ABC002435892e-21236 - 2949757 / 59plus
Harvest21ABC002407982e-21303 - 3619757 / 59plus
Harvest21ABC0023211322e-21463 - 5219757 / 59plus
Harvest21ABC002146982e-21296 - 3549757 / 59plus
Harvest21ABC324467478e-21690 - 7479756 / 58plus
Harvest35U35_506635573e-2568 - 12710060 / 60plus
Harvest35U35_505626373e-25377 - 43610060 / 60plus
Harvest35U35_505615623e-25446 - 50510060 / 60plus
Harvest35U35_505285603e-25432 - 49110060 / 60plus
Harvest35U35_452055713e-25134 - 19310060 / 60plus
Harvest35U35_451174823e-25341 - 40010060 / 60plus
Harvest35U35_451115123e-25225 - 28410060 / 60plus
Harvest35U35_385006613e-25426 - 48510060 / 60plus
Harvest35U35_383576783e-25170 - 22910060 / 60plus
Harvest35U35_373175283e-25387 - 44610060 / 60plus
Harvest35U35_372165223e-25245 - 30410060 / 60plus
Harvest35U35_372145513e-25397 - 45610060 / 60plus
Harvest35U35_371435413e-25357 - 41610060 / 60plus
Harvest35U35_296006053e-25308 - 36710060 / 60plus
Harvest35U35_3296173e-25400 - 45910060 / 60plus
Harvest35U35_3189773e-25436 - 49510060 / 60plus
Harvest35U35_3158783e-25744 - 80310060 / 60plus
Harvest35U35_31412353e-25642 - 70110060 / 60plus
Harvest35U35_3139343e-25261 - 32010060 / 60plus
Harvest35U35_3056373e-25317 - 37610060 / 60plus
Harvest35U35_3036053e-25171 - 23010060 / 60plus
Harvest35U35_30210803e-25744 - 80310060 / 60plus
Harvest35U35_2276613e-25381 - 44010060 / 60plus
Harvest35U35_2119843e-25304 - 36310060 / 60plus
Harvest35U35_2079053e-25299 - 35810060 / 60plus
Harvest35U35_2066023e-25256 - 31510060 / 60plus
Harvest35U35_2047063e-25247 - 30610060 / 60plus
Harvest35U35_2035833e-25427 - 48610060 / 60plus
Harvest35U35_19712063e-25524 - 58310060 / 60plus
Harvest35U35_1966853e-25335 - 39410060 / 60plus
Harvest35U35_1157113e-25281 - 34010060 / 60plus
Harvest35U35_1106333e-25421 - 48010060 / 60plus
Harvest35U35_1096303e-25419 - 47810060 / 60plus
Harvest35U35_1066713e-25385 - 44410060 / 60plus
Harvest35U35_1056493e-25584 - 64310060 / 60plus
Harvest35U35_887203e-25338 - 39710060 / 60plus
Harvest35U35_8210853e-25403 - 46210060 / 60plus
Harvest35U35_776333e-25404 - 46310060 / 60plus
Harvest35U35_689553e-25460 - 51910060 / 60plus
Harvest35U35_236343e-25313 - 37210060 / 60plus
Harvest35U35_86783e-25383 - 44210060 / 60plus
Harvest35U35_78283e-25479 - 53810060 / 60plus
Harvest35U35_384577301e-23423 - 4829859 / 60plus
Harvest35U35_383606921e-23357 - 4169859 / 60plus
Harvest35U35_381766321e-2387 - 1469859 / 60plus
Harvest35U35_372806601e-23415 - 4749859 / 60plus
Harvest35U35_371025531e-23424 - 4839859 / 60plus
Harvest35U35_2245181e-23427 - 4869859 / 60plus
Harvest35U35_2196081e-23508 - 5679859 / 60plus
Harvest35U35_247291e-23301 - 3609859 / 60plus
Harvest35U35_506425785e-23375 - 4339858 / 59plus
Harvest35U35_505175485e-23401 - 4599858 / 59plus
Harvest35U35_451486295e-23351 - 4099858 / 59plus
Harvest35U35_33729005e-23956 - 10149858 / 59plus
Harvest35U35_3306715e-23315 - 3739858 / 59plus
Harvest35U35_3276315e-23341 - 3999858 / 59plus
Harvest35U35_32110895e-23398 - 4569858 / 59plus
Harvest35U35_3197245e-23321 - 3799858 / 59plus
Harvest35U35_31210465e-23614 - 6729858 / 59plus
Harvest35U35_3066935e-23336 - 3949858 / 59plus
Harvest35U35_3045775e-23336 - 3949858 / 59plus
Harvest35U35_3006695e-23245 - 3039858 / 59plus
Harvest35U35_2185995e-23234 - 2929858 / 59plus
Harvest35U35_2026525e-23158 - 2169858 / 59plus
Harvest35U35_1985985e-23294 - 3529858 / 59plus
Harvest35U35_371595082e-22226 - 2839857 / 58plus
Harvest35U35_905656e-22272 - 3289856 / 57plus
Harvest35U35_7911206e-22440 - 4969856 / 57plus
Harvest35U35_259396e-22285 - 3419856 / 57plus
Harvest35U35_384776332e-21231 - 2899757 / 59plus
Harvest35U35_382497022e-21363 - 4219757 / 59plus
Harvest35U35_381946202e-21337 - 3959757 / 59plus
Harvest35U35_381696082e-21323 - 3819757 / 59plus
Harvest35U35_372565472e-21198 - 2569757 / 59plus
Harvest35U35_371555702e-21283 - 3419757 / 59plus
Harvest35U35_34214172e-21748 - 8069757 / 59plus
Harvest35U35_33913792e-21692 - 7509757 / 59plus
Harvest35U35_2266912e-21225 - 2839757 / 59plus
Harvest35U35_2136382e-21304 - 3629757 / 59plus
Harvest35U35_1149742e-21307 - 3659757 / 59plus
Harvest35U35_876022e-21253 - 3119757 / 59plus
Harvest35U35_847012e-21376 - 4349757 / 59plus
Harvest35U35_815892e-21236 - 2949757 / 59plus
Harvest35U35_784882e-21303 - 3619757 / 59plus
Harvest35U35_7511412e-21460 - 5189757 / 59plus
Harvest35U35_98612e-21746 - 8049757 / 59plus
Harvest35U35_369387478e-21690 - 7479756 / 58plus



Contig Sequence (562 bp)

>U35_50561 562 Hv_44K_v2
AACACTAGTTAACACCAATCCACCATGAAGACCTTCCTCATCTTTGCACTCCTTGCCATT
GCGGCAACAAGTACCATTGCACAACAACAACCATTTCCACAACAACCCATCCCACAACAA
CCACAACCATACCCACAACAACCACAACCATACCCACAACAACCACAACCATTTCCACAA
CAACCCATCCCACAACAACCACAACCATACCCACAACAACCACAACCATTTCCACAACAA
CCCATCCCACAACAACCACAACCATACCCACAACAACCACAACCATTTCCCCTACAACCC
TTCCCATCACAACAACCATTTCCACAACAACCACCATTTTGGCAACAACAACCAGTTCTA
TCGCAGCAACAACCATGTACACAAGAACAAACACCACTCCTACAAGAACAACAAGATCAA
ATGCTTCTGCAAGTACAAATACCATTTGTTCATCCATCTATTTTGCAGCAGCTAAACCCA
TGCAAGGTATTCCTCCAGCAGCAGTGCAGCCCTGTGGCAATGTCACAACGTATTGCAAGG
TCGCAGATGTTGCAACAGAGCA



Homology of Contig U35_50561 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None