Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_26608_PI390587928Hv_44K_v2TATTGCTAGGTTGCAAATGTTGCAGCTGAGCAGTTGCCATGTGTTGCAGCAACAATGTTG484GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0110.0120.1432.7246.54810.691
Raw 10.63316.134293.5568247.8876985.74012429.667



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_75622.116513e-211271 - 13309758 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
MLOCMLOC_6381.110353e-21516 - 5759758 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
JLOC1JLOC1_50450.110842e-21704 - 7639758 / 60minus
JLOC1JLOC1_4154.110672e-21539 - 5989758 / 60minus
Harvest21ABC529085783e-25459 - 51810060 / 60plus
Harvest21ABC528244273e-25337 - 39610060 / 60plus
Harvest21ABC528215633e-25411 - 47010060 / 60plus
Harvest21ABC527806683e-25435 - 49410060 / 60plus
Harvest21ABC527725973e-25435 - 49410060 / 60plus
Harvest21ABC527005483e-25485 - 54410060 / 60plus
Harvest21ABC007986313e-25425 - 48410060 / 60plus
Harvest21ABC007957853e-25531 - 59010060 / 60plus
Harvest21ABC007859993e-25405 - 46410060 / 60plusABC00785
Harvest21ABC344616331e-23315 - 3749859 / 60plus
Harvest21ABC341595481e-23345 - 4049859 / 60plus
Harvest21ABC341377021e-23447 - 5069859 / 60plus
Harvest21ABC340566201e-23421 - 4809859 / 60plus
Harvest21ABC331104911e-23302 - 3619859 / 60plus
Harvest21ABC324525881e-23503 - 5629859 / 60plus
Harvest21ABC322925821e-23379 - 4389859 / 60plus
Harvest21ABC0081814111e-23776 - 8359859 / 60plus
Harvest21ABC002585971e-23332 - 3919859 / 60plus
Harvest21ABC002527011e-23460 - 5199859 / 60plus
Harvest21ABC530128686e-22328 - 3879758 / 60plusABC53012
Harvest21ABC452713296e-22243 - 3029758 / 60plus
Harvest21ABC447154906e-22419 - 4789758 / 60plus
Harvest21ABC436276296e-22435 - 4949758 / 60plus
Harvest21ABC342775736e-22457 - 5169758 / 60plus
Harvest21ABC329985476e-22282 - 3419758 / 60plus
Harvest21ABC328435656e-22338 - 3979758 / 60plus
Harvest21ABC328225706e-22367 - 4269758 / 60plus
Harvest21ABC0081529006e-221040 - 10999758 / 60plusABC00815
Harvest21ABC007637636e-22498 - 5579758 / 60plus
Harvest21ABC005859206e-22370 - 4299758 / 60plusABC00585
Harvest21ABC005826896e-22309 - 3689758 / 60plus
Harvest21ABC005609716e-22401 - 4609758 / 60plus
Harvest21ABC005486386e-22389 - 4489758 / 60plus
Harvest21ABC0054310366e-22432 - 4919758 / 60plus
Harvest21ABC005298046e-22242 - 3019758 / 60plus
Harvest21ABC005286026e-22253 - 3129758 / 60plus
Harvest21ABC005248746e-22563 - 6229758 / 60plusABC00524
Harvest21ABC005085966e-22378 - 4379758 / 60plus
Harvest21ABC002968616e-22393 - 4529758 / 60plus
Harvest21ABC002926846e-22391 - 4509758 / 60plus
Harvest21ABC0028510086e-22407 - 4669758 / 60plus
Harvest21ABC002665656e-22356 - 4159758 / 60plus
Harvest21ABC002648956e-22517 - 5769758 / 60plus
Harvest21ABC0024111196e-22524 - 5839758 / 60plusABC00241
Harvest21ABC002407986e-22387 - 4469758 / 60plus
Harvest21ABC0023211326e-22547 - 6069758 / 60plus
Harvest21ABC002146986e-22380 - 4399758 / 60plus
Harvest35U35_506425783e-25459 - 51810060 / 60plus
Harvest35U35_505175483e-25485 - 54410060 / 60plus
Harvest35U35_3276313e-25425 - 48410060 / 60plus
Harvest35U35_3197243e-25405 - 46410060 / 60plus
Harvest35U35_384776331e-23315 - 3749859 / 60plus
Harvest35U35_382497021e-23447 - 5069859 / 60plus
Harvest35U35_381946201e-23421 - 4809859 / 60plus
Harvest35U35_33913791e-23776 - 8359859 / 60plus
Harvest35U35_876021e-23337 - 3969859 / 60plus
Harvest35U35_847011e-23460 - 5199859 / 60plus
Harvest35U35_451486296e-22435 - 4949758 / 60plus
Harvest35U35_381696086e-22407 - 4669758 / 60plus
Harvest35U35_372565476e-22282 - 3419758 / 60plus
Harvest35U35_371555706e-22367 - 4269758 / 60plus
Harvest35U35_34214176e-22832 - 8919758 / 60plus
Harvest35U35_33729006e-221040 - 10999758 / 60plus
Harvest35U35_2266916e-22309 - 3689758 / 60plus
Harvest35U35_2136386e-22388 - 4479758 / 60plus
Harvest35U35_2026526e-22242 - 3019758 / 60plus
Harvest35U35_1985986e-22378 - 4379758 / 60plus
Harvest35U35_1149746e-22391 - 4509758 / 60plus
Harvest35U35_905656e-22356 - 4159758 / 60plus
Harvest35U35_7911206e-22524 - 5839758 / 60plus
Harvest35U35_784886e-22387 - 4469758 / 60plus
Harvest35U35_7511416e-22544 - 6039758 / 60plus



Contig Sequence (548 bp)

>U35_50517 548 Hv_44K_v2
CTAGTTAACACCAATCCACCATGAAGACCTTCCTCATCTTTGCACTCCTGGCCATTGCGG
CAACAAGTACGATTGCGCAGCAACAACCACTTCCGCAACAACCCATCCCACAAAAACCAC
AACCATACCCACAACAACCCTTCCCACCGCAACAACCATTTCCACAACAACCCGTCCCAC
AACAACCACAACCATACCCACAACAACCACAACAACCCTTCCCACCGCAACAACCATTTC
CACAACAACCACCATTTTGGCCACAACAACCATTTCCACAGCAACCACCATTTGGGCTAC
AACAACGAATTCTATCGCAGCAACAACCATGTACACCACAACAAACACCACTCCCACAAG
GACAACTGTATCAAACGCTTCTGCAACTACAAATACCCTATGTTCATCCATCTATTTTGC
AACAGCTAAACCCATGCAAGGTATTCCTCCAGCAGCAGTGCAGCCCCGTGCGAATGCCAC
AACTTATTGCTAGGTTGCAAATGTTGCAGCTGAGCAGTTGCCATGTGTTGCAGCAACAAT
GTTGCCAG



Homology of Contig U35_50517 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None