Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_1125_PI390587928Hv_44K_v2TATTGCAAGGTCGCAAATGTTGCAACAGAGCAGTTGCCATGTGTTGCAGCAACAATGTTG309GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0120.0120.1612.5165.5368.774
Raw 11.83620.462393.5258979.6476963.81712222.833



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_28499.13212e-2485 - 14410060 / 60plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_47363.14077e-23158 - 2179859 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_27672.12367e-2315 - 749859 / 60plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_75622.116513e-211271 - 13309758 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00811 ABC00815 ABC00822 ABC32263 ABC32949 ABC37919 ABC44727 ABC53012
JLOC1JLOC1_19111.13218e-2585 - 14410060 / 60plus
JLOC1JLOC1_30552.14074e-23158 - 2179859 / 60minus
JLOC1JLOC1_18660.12364e-2315 - 749859 / 60plus
JLOC1JLOC1_50450.110842e-21704 - 7639758 / 60minus
Harvest21ABC452964543e-25385 - 44410060 / 60plus
Harvest21ABC450546613e-25466 - 52510060 / 60plus
Harvest21ABC438506003e-25339 - 39810060 / 60plus
Harvest21ABC435994573e-25386 - 44510060 / 60plus
Harvest21ABC435565123e-25310 - 36910060 / 60plus
Harvest21ABC344846763e-25220 - 27910060 / 60plus
Harvest21ABC344377303e-25508 - 56710060 / 60plus
Harvest21ABC343247113e-25366 - 42510060 / 60plus
Harvest21ABC343026923e-25442 - 50110060 / 60plus
Harvest21ABC342996783e-25255 - 31410060 / 60plus
Harvest21ABC340336323e-25172 - 23110060 / 60plus
Harvest21ABC330426603e-25500 - 55910060 / 60plus
Harvest21ABC329315223e-25330 - 38910060 / 60plus
Harvest21ABC329295513e-25482 - 54110060 / 60plus
Harvest21ABC328325083e-25309 - 36810060 / 60plus
Harvest21ABC328045413e-25442 - 50110060 / 60plus
Harvest21ABC326526283e-25484 - 54310060 / 60plus
Harvest21ABC322704683e-25265 - 32410060 / 60plus
Harvest21ABC298376813e-25386 - 44510060 / 60plus
Harvest21ABC0078111723e-25573 - 63210060 / 60plus
Harvest21ABC007618323e-25594 - 65310060 / 60plus
Harvest21ABC005745023e-25375 - 43410060 / 60plus
Harvest21ABC005345453e-25385 - 44410060 / 60plus
Harvest21ABC005317043e-25332 - 39110060 / 60plus
Harvest21ABC0053010963e-25512 - 57110060 / 60plusABC00530
Harvest21ABC0052312353e-25637 - 69610060 / 60plusABC00523
Harvest21ABC0050612023e-25609 - 66810060 / 60plus
Harvest21ABC005056203e-25419 - 47810060 / 60plus
Harvest21ABC003044373e-25306 - 36510060 / 60plus
Harvest21ABC003027133e-25370 - 42910060 / 60plus
Harvest21ABC003019703e-25378 - 43710060 / 60plusABC00301
Harvest21ABC002876303e-25504 - 56310060 / 60plus
Harvest21ABC002836713e-25470 - 52910060 / 60plus
Harvest21ABC0025910113e-25423 - 48210060 / 60plus
Harvest21ABC002565913e-25465 - 52410060 / 60plus
Harvest21ABC002475803e-25479 - 53810060 / 60plus
Harvest21ABC002446203e-25488 - 54710060 / 60plus
Harvest21ABC0021115153e-25599 - 65810060 / 60plus
Harvest21ABC000225053e-25410 - 46910060 / 60plus
Harvest21ABC002485474e-24485 - 5449859 / 60plus
Harvest21ABC438381971e-23141 - 19710057 / 57plus
Harvest21ABC435664821e-23426 - 48210057 / 57plus
Harvest21ABC331065281e-23472 - 52810057 / 57plus
Harvest21ABC298296341e-23398 - 4579859 / 60plus
Harvest21ABC289566051e-23393 - 4529859 / 60plus
Harvest21ABC007726621e-23462 - 5219859 / 60plus
Harvest21ABC0076512401e-23706 - 7659859 / 60plusABC00765
Harvest21ABC0057710911e-23496 - 5559859 / 60plus
Harvest21ABC005636501e-23365 - 4249859 / 60plus
Harvest21ABC005525351e-23402 - 4619859 / 60plus
Harvest21ABC005498681e-23332 - 3919859 / 60plusABC00549
Harvest21ABC005409771e-23389 - 4489859 / 60plusABC00540
Harvest21ABC002896221e-23506 - 5659859 / 60plus
Harvest21ABC002465971e-23483 - 5429859 / 60plus
Harvest21ABC326004212e-22365 - 4219856 / 57plus
Harvest21ABC530128686e-22328 - 3879758 / 60plusABC53012
Harvest21ABC529003586e-22257 - 3169758 / 60plus
Harvest21ABC452713296e-22243 - 3029758 / 60plus
Harvest21ABC447154906e-22419 - 4789758 / 60plus
Harvest21ABC437355716e-22219 - 2789758 / 60plus
Harvest21ABC344976616e-22511 - 5709758 / 60plus
Harvest21ABC342775736e-22457 - 5169758 / 60plus
Harvest21ABC329985476e-22282 - 3419758 / 60plus
Harvest21ABC328225706e-22367 - 4269758 / 60plus
Harvest21ABC0081529006e-221040 - 10999758 / 60plusABC00815
Harvest21ABC007996816e-22416 - 4759758 / 60plus
Harvest21ABC0079310916e-22492 - 5519758 / 60plusABC00793
Harvest21ABC007916316e-22504 - 5639758 / 60plus
Harvest21ABC007838016e-22416 - 4759758 / 60plus
Harvest21ABC007637636e-22498 - 5579758 / 60plus
Harvest21ABC007606376e-22402 - 4619758 / 60plus
Harvest21ABC007576056e-22256 - 3159758 / 60plus
Harvest21ABC007558746e-22679 - 7389758 / 60plus
Harvest21ABC005826896e-22309 - 3689758 / 60plus
Harvest21ABC005609716e-22401 - 4609758 / 60plus
Harvest21ABC0054310366e-22432 - 4919758 / 60plus
Harvest21ABC005298046e-22242 - 3019758 / 60plus
Harvest21ABC005286026e-22253 - 3129758 / 60plus
Harvest21ABC005248746e-22563 - 6229758 / 60plusABC00524
Harvest21ABC005085966e-22378 - 4379758 / 60plus
Harvest21ABC0030510306e-22486 - 5459758 / 60plus
Harvest21ABC002968616e-22393 - 4529758 / 60plus
Harvest21ABC002926846e-22391 - 4509758 / 60plus
Harvest21ABC0028510086e-22407 - 4669758 / 60plus
Harvest21ABC002665656e-22356 - 4159758 / 60plus
Harvest21ABC002648956e-22517 - 5769758 / 60plus
Harvest21ABC0024111196e-22524 - 5839758 / 60plusABC00241
Harvest21ABC002407986e-22387 - 4469758 / 60plus
Harvest21ABC0023211326e-22547 - 6069758 / 60plus
Harvest21ABC002146986e-22380 - 4399758 / 60plus
Harvest35U35_451115123e-25310 - 36910060 / 60plus
Harvest35U35_384577303e-25508 - 56710060 / 60plus
Harvest35U35_383606923e-25442 - 50110060 / 60plus
Harvest35U35_383576783e-25255 - 31410060 / 60plus
Harvest35U35_381766323e-25172 - 23110060 / 60plus
Harvest35U35_372806603e-25500 - 55910060 / 60plus
Harvest35U35_372165223e-25330 - 38910060 / 60plus
Harvest35U35_372145513e-25482 - 54110060 / 60plus
Harvest35U35_371595083e-25309 - 36810060 / 60plus
Harvest35U35_371435413e-25442 - 50110060 / 60plus
Harvest35U35_3296173e-25485 - 54410060 / 60plus
Harvest35U35_3189773e-25521 - 58010060 / 60plus
Harvest35U35_2276613e-25466 - 52510060 / 60plus
Harvest35U35_2079053e-25384 - 44310060 / 60plus
Harvest35U35_2066023e-25341 - 40010060 / 60plus
Harvest35U35_2035833e-25512 - 57110060 / 60plus
Harvest35U35_19712063e-25609 - 66810060 / 60plus
Harvest35U35_1966853e-25420 - 47910060 / 60plus
Harvest35U35_1096303e-25504 - 56310060 / 60plus
Harvest35U35_1066713e-25470 - 52910060 / 60plus
Harvest35U35_887203e-25423 - 48210060 / 60plus
Harvest35U35_776333e-25489 - 54810060 / 60plus
Harvest35U35_689553e-25545 - 60410060 / 60plus
Harvest35U35_247293e-25386 - 44510060 / 60plus
Harvest35U35_451174821e-23426 - 48210057 / 57plus
Harvest35U35_373175281e-23472 - 52810057 / 57plus
Harvest35U35_296006051e-23393 - 4529859 / 60plus
Harvest35U35_30210801e-23829 - 8889859 / 60plus
Harvest35U35_2119841e-23389 - 4489859 / 60plus
Harvest35U35_2047061e-23332 - 3919859 / 60plus
Harvest35U35_1157111e-23366 - 4259859 / 60plus
Harvest35U35_8210851e-23488 - 5479859 / 60plus
Harvest35U35_236341e-23398 - 4579859 / 60plus
Harvest35U35_86781e-23468 - 5279859 / 60plus
Harvest35U35_505626376e-22462 - 5219758 / 60plus
Harvest35U35_452055716e-22219 - 2789758 / 60plus
Harvest35U35_385006616e-22511 - 5709758 / 60plus
Harvest35U35_381696086e-22407 - 4669758 / 60plus
Harvest35U35_372565476e-22282 - 3419758 / 60plus
Harvest35U35_371555706e-22367 - 4269758 / 60plus
Harvest35U35_34214176e-22832 - 8919758 / 60plus
Harvest35U35_33729006e-221040 - 10999758 / 60plus
Harvest35U35_31412356e-22727 - 7869758 / 60plus
Harvest35U35_3056376e-22402 - 4619758 / 60plus
Harvest35U35_3036056e-22256 - 3159758 / 60plus
Harvest35U35_2266916e-22309 - 3689758 / 60plus
Harvest35U35_2026526e-22242 - 3019758 / 60plus
Harvest35U35_1985986e-22378 - 4379758 / 60plus
Harvest35U35_1149746e-22391 - 4509758 / 60plus
Harvest35U35_1106336e-22506 - 5659758 / 60plus
Harvest35U35_905656e-22356 - 4159758 / 60plus
Harvest35U35_7911206e-22524 - 5839758 / 60plus
Harvest35U35_784886e-22387 - 4469758 / 60plus
Harvest35U35_7511416e-22544 - 6039758 / 60plus
Harvest35U35_78286e-22564 - 6239758 / 60plus



Contig Sequence (512 bp)

>U35_45111 512 Hv_44K_v2
AAGAAACACTAGTTAATACCAATCCACCATGAAGACCTTCCTCATCTTTGCACTCCTCGC
CATTGTGGCAACAACTACCATTGCATCACAACAACCATTTCCACAACAACCACCATTTTG
GCAACAACAACCAGTTCTATCGCAGCAACAACCATGTACACAAGACCAAACACCACTCCT
ACAAGAACAACAAGATCAAATGCTTGTGCAAGTACAAATACCATTTGTTCATCCATCTAT
TTTGCAGCAGCTAAACCCATGCAAGGTATTCCTCCAGCAGCAGTGCAGCCCTGTGGCAAT
GTCACAACGTATTGCAAGGTCGCAAATGTTGCAACAGAGCAGTTGCCATGTGTTGCAGCA
ACAATGTTGCCAACAACTGCCGCAAATCCCCGAACAACTCCGCCATGAGGCAGTCCGTGC
AATCGTCTACTCTATCGTCCTGCAAGAACAATCCCTACAATTGGTCCAAGGTGTCTCCCA
ACCCCAACAACAGTCACAACAGCAACAAGTCG



Homology of Contig U35_45111 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None