- Transcript BART1_0-u35643.012
- Transcript IDBART1_0-u35643.012
- Gene IDBART1_0-u35643
Exon Structure of BART1_0-u35643.012
Chromosome | Exon | Start | Stop | Direction |
---|---|---|---|---|
chr5H | 1 | 395640964 | 395640848 | - |
chr5H | 2 | 395641445 | 395641126 | - |
grey: non-coding, green: Barley Morex IBSC 2017 Transcript CDS, red: Barley RTD exons
Salmon TPM Values: sixteensamplesmorex
These TPM values were generated by using the RNA-seq data from a 16-tissue experiment in Morex (published here) were calculated using Salmon (version Salmon-0.8.2) using BaRTv1.0-QUASI as the reference transcript dataset. Click here for more information about the RNA-seq experiment and materialsSample | Treatment | Rep 1 | Rep 2 | Rep 3 |
---|---|---|---|---|
morex | EMB | 0 | 0.412102 | 0.288092 |
morex | ETI | 0.467889 | 0.337573 | 0.156544 |
morex | LEA | 0.666854 | 1.16692 | 2.52057 |
morex | EPI | 0.78477 | 0.155762 | 0.49944 |
morex | ROO | 0 | 0.295287 | 0.169747 |
morex | ROO2 | 0.22114 | 0.314238 | 0 |
morex | NOD | 0 | 0.282114 | 0.244795 |
morex | RAC | 0 | 0 | 0 |
morex | INF1 | 0.185804 | 0 | 0 |
morex | INF2 | 0.200412 | 0.453865 | 0.275685 |
morex | CAR5 | 0.274182 | 0 | 0 |
morex | CAR15 | 0.194282 | 0.679503 | 0 |
morex | LEM | 0.226736 | 0 | 0 |
morex | LOD | 0 | 0 | 0.208833 |
morex | PAL | 0 | 0 | 0 |
morex | SEN | 1.51164 | 1.69243 | 0 |
Homology to Model Species (BLASTX to E-value < 1e-30)
Database | Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Rice PP7 | None | - | - | - | - | - |
TAIR PP10 | None | - | - | - | - | - |
BRACH PP3 | None | - | - | - | - | - |
Barley PseudoMolecules GBrowse
Click here to see more tracks within GBrowse -->
grey: non-coding, green: Barley Morex IBSC 2017 Transcript CDS, red: Barley RTD exons
CDS Sequence (437 bp)
>BART1_0-u35643.012 437 150831_barley_pseudomolecules CACACACCGTCCCGTAAACAAAAAGACGAAAAATAGCCTGCCCTTCCTTCCTCTCTTCCC CTCCCCAAAATTCCCCTCTCCTTCTCTCGCTCCAGTCGCGACGGCGACGGCGACGACGAC GACGACGATCAGGTATCAATCCCCCGCCCCCTCCCCTCCCTCGCCCGATTCGCGCAGATT ATTCCCCATCGCTCCCCCGATTGCGAGTTTCCAGCTCCGGAGCAGTAGGTTTTGGCTAGA ACCCGCCTCCGTAGCCGTCGGTTGTTGGGGTTAAGGGAGATCCGGCAAGAGGCCCTCTGT TGCCGGCGGCGGATTTGGGCTTCGTTGCAGGTGATGGTACTGATGTTCAATTGATTAATG ATGACTGTTCCGATGGATAGTACTGCTGTTCCGCCATCGCGGGACCTCGTGCAGCGCCTC CTTAAGAAGGTGAGCTT
Protein Sequence ( aa)
>BART1_0-u35643.012 150831_barley_pseudomolecules