- Transcript BART1_0-u30899.007
- Transcript IDBART1_0-u30899.007
- Gene IDBART1_0-u30899
Exon Structure of BART1_0-u30899.007
| Chromosome | Exon | Start | Stop | Direction |
|---|---|---|---|---|
| chr4H | 1 | 593062202 | 593062081 | + |
| chr4H | 2 | 593070355 | 593070074 | + |
grey: non-coding, green: Barley Morex IBSC 2017 Transcript CDS, red: Barley RTD exons
Salmon TPM Values: sixteensamplesmorex
These TPM values were generated by using the RNA-seq data from a 16-tissue experiment in Morex (published here) were calculated using Salmon (version Salmon-0.8.2) using BaRTv1.0-QUASI as the reference transcript dataset. Click here for more information about the RNA-seq experiment and materials
| Sample | Treatment | Rep 1 | Rep 2 | Rep 3 |
|---|---|---|---|---|
| morex | EMB | 0 | 0 | 0 |
| morex | ETI | 0 | 0 | 0 |
| morex | LEA | 0 | 0 | 0 |
| morex | EPI | 0 | 0.324156 | 0 |
| morex | ROO | 0 | 0 | 0 |
| morex | ROO2 | 0 | 0.401368 | 0 |
| morex | NOD | 0 | 0 | 0 |
| morex | RAC | 0 | 0.84317 | 0 |
| morex | INF1 | 0 | 0 | 0 |
| morex | INF2 | 0 | 0 | 0 |
| morex | CAR5 | 0 | 0 | 0 |
| morex | CAR15 | 0 | 0 | 0 |
| morex | LEM | 0 | 0 | 0 |
| morex | LOD | 0 | 0.609674 | 0 |
| morex | PAL | 0.839897 | 0.379661 | 0.268495 |
| morex | SEN | 0 | 0 | 0 |
Homology to Model Species (BLASTX to E-value < 1e-30)
| Database | Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Rice PP7 | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |
| BRACH PP3 | None | - | - | - | - | - |
Barley PseudoMolecules GBrowse
Click here to see more tracks within GBrowse -->
grey: non-coding, green: Barley Morex IBSC 2017 Transcript CDS, red: Barley RTD exons
CDS Sequence (404 bp)
>BART1_0-u30899.007 404 150831_barley_pseudomolecules CCCCTGCCGTGGCGGCGCGGCGGCGCGATTCCTTTGCTGCTCGGCGGCAGCGGCCGACGG AAGCAGCGGCCGGGGTAGCAGCGACGGCAAGGCTCGGTTCTCTCCTCTCCCTCCCAACCA AGATTTGGTGTGAAGGATGGTGCTCTGTTCCTATGAGCAGTAGGCTCGCTGGGATTTTGG GCTTTGCCGTGTATTTTGGTCCCTGCTTGGCATACCGTTTTCTGCACATTACAGGTGTAA AATAAATACAGACCTCCATCCACTGGTTTAGTTTCCAGCCGGAAGACACTCATGTCCAGT AAAATACACCTGTAAATTTTACATCCCTGTATTAAATTACACCTATACCAAGCGCATCCT TAGCGTTTCATATATGAGAATCTGGTGGTTACCCTATAGTCTGT
Protein Sequence ( aa)
>BART1_0-u30899.007 150831_barley_pseudomolecules