Probe CUST_1368_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_1368_PI426222305 | JHI_St_60k_v1 | DMT400052105 | GAGCTAGCTAGGTAGCTAGTATATTGAAATAATTGGACAGGGTTAGGTTGCAACTAAAGT |
All Microarray Probes Designed to Gene DMG400020225
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_1368_PI426222305 | JHI_St_60k_v1 | DMT400052105 | GAGCTAGCTAGGTAGCTAGTATATTGAAATAATTGGACAGGGTTAGGTTGCAACTAAAGT |
Microarray Signals from CUST_1368_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 7.54369 | 3.72382 | 1.0361 | 0.530951 |
| ABA 1h | 170.855 | 36.4066 | 25.6889 | 4.39197 |
| ACC 1h | 8.20776 | 4.00361 | 1.06458 | 0.549263 |
| BABA 1h | 6.61493 | 3.83894 | 0.960781 | 0.55752 |
| Chitin 1h | 6.55192 | 3.71434 | 1.01964 | 0.576414 |
| Epi 1h | 6.18864 | 3.58739 | 1.00016 | 0.579161 |
| SA 1h | 6.3002 | 3.64846 | 0.85875 | 0.497299 |
| Me-JA 1h | 6.4515 | 3.743 | 1.10445 | 0.639569 |
| Control 6h | 8.56417 | 3.74206 | 1.1271 | 0.552327 |
| ABA 6h | 257.477 | 56.962 | 32.0184 | 6.49952 |
| ACC 6h | 9.30307 | 4.61482 | 1.10301 | 0.555039 |
| BABA 6h | 13.1248 | 6.20837 | 1.33441 | 0.659352 |
| Chitin 6h | 84.7266 | 77.6105 | 3.02385 | 12.3402 |
| Epi 6h | 10.9108 | 4.54494 | 1.27926 | 0.610051 |
| SA 6h | 10.7059 | 4.0683 | 1.34844 | 0.712241 |
| Me-JA 6h | 16.0506 | 7.43507 | 1.85227 | 0.73161 |
Source Transcript PGSC0003DMT400052105 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | Solyc02g093890.1 | +3 | 3e-147 | 437 | 246/285 (86%) | evidence_code:10F0H1E0IEG genomic_reference:SL2.50ch02 gene_region:49173963-49174790 transcript_region:SL2.50ch02:49173963..49174790- functional_description:Unknown Protein (AHRD V1) |
| TAIR PP10 | AT3G27250.1 | +3 | 9e-42 | 155 | 114/287 (40%) | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40800.1); Has 104 Blast hits to 104 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:10061633-10062481 FORWARD LENGTH=282 |