All Microarray Probes on Gene DMG400020225

Probe IDChip nameTranscript IDProbe Sequence
CUST_1368_PI426222305 JHI_St_60k_v1 DMT400052105 GAGCTAGCTAGGTAGCTAGTATATTGAAATAATTGGACAGGGTTAGGTTGCAACTAAAGT


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400020225

Click here to view details at Spud DB Genome Browser (opens in new window)