Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_40719_PI390587928Hv_44K_v2AACACCACTCCTACAAGAACAACAAGATCAAATGCTTCTGCAAGTACAAATACCATTTGT316GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0160.0150.1432.7805.3408.598
Raw 4.4625.23472.9672049.3751417.4842532.945



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_65457.12957e-23121 - 1809859 / 60minus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00585 ABC00711 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
JLOC1JLOC1_43078.12954e-23121 - 1809859 / 60minus
Harvest21ABC528874763e-25392 - 45110060 / 60plus
Harvest21ABC527685623e-25390 - 44910060 / 60plus
Harvest21ABC527215603e-25376 - 43510060 / 60plus
Harvest21ABC343247113e-25225 - 28410060 / 60plus
Harvest21ABC341755833e-25462 - 52110060 / 60plus
Harvest21ABC340295533e-25472 - 53110060 / 60plus
Harvest21ABC329315223e-25189 - 24810060 / 60plus
Harvest21ABC329295513e-25341 - 40010060 / 60plus
Harvest21ABC328045413e-25301 - 36010060 / 60plus
Harvest21ABC008084113e-25317 - 37610060 / 60plus
Harvest21ABC008025253e-25344 - 40310060 / 60plus
Harvest21ABC007996813e-25275 - 33410060 / 60plus
Harvest21ABC0079310913e-25351 - 41010060 / 60plusABC00793
Harvest21ABC007916313e-25363 - 42210060 / 60plus
Harvest21ABC007749343e-25557 - 61610060 / 60plus
Harvest21ABC007606373e-25261 - 32010060 / 60plus
Harvest21ABC007558743e-25538 - 59710060 / 60plus
Harvest21ABC007548593e-25688 - 74710060 / 60plus
Harvest21ABC003019703e-25237 - 29610060 / 60plusABC00301
Harvest21ABC002896223e-25365 - 42410060 / 60plus
Harvest21ABC002876303e-25363 - 42210060 / 60plus
Harvest21ABC002836713e-25329 - 38810060 / 60plus
Harvest21ABC002475803e-25338 - 39710060 / 60plus
Harvest21ABC002465973e-25342 - 40110060 / 60plus
Harvest21ABC0021115153e-25458 - 51710060 / 60plus
Harvest21ABC452964541e-23244 - 3039859 / 60plus
Harvest21ABC452645681e-23493 - 5529859 / 60plus
Harvest21ABC450546611e-23325 - 3849859 / 60plus
Harvest21ABC437225791e-23430 - 4899859 / 60plus
Harvest21ABC435994571e-23245 - 3049859 / 60plus
Harvest21ABC435565121e-23169 - 2289859 / 60plus
Harvest21ABC434314341e-23283 - 3429859 / 60plus
Harvest21ABC289566051e-23252 - 3119859 / 60plus
Harvest21ABC005745021e-23234 - 2939859 / 60plus
Harvest21ABC005636501e-23224 - 2839859 / 60plus
Harvest21ABC005525351e-23261 - 3209859 / 60plus
Harvest21ABC005498681e-23191 - 2509859 / 60plusABC00549
Harvest21ABC005345451e-23244 - 3039859 / 60plus
Harvest21ABC005317041e-23191 - 2509859 / 60plus
Harvest21ABC0053010961e-23371 - 4309859 / 60plusABC00530
Harvest21ABC005194831e-23337 - 3969859 / 60plus
Harvest21ABC005125431e-23354 - 4139859 / 60plus
Harvest21ABC0050612021e-23468 - 5279859 / 60plus
Harvest21ABC005056201e-23278 - 3379859 / 60plus
Harvest21ABC003044371e-23165 - 2249859 / 60plus
Harvest21ABC000225051e-23269 - 3289859 / 60plus
Harvest21ABC437612856e-22190 - 2499758 / 60plus
Harvest21ABC322971016e-2210 - 699758 / 60plus
Harvest21ABC298296346e-22260 - 3169856 / 57plus
Harvest21ABC0076512406e-22568 - 6249856 / 57plusABC00765
Harvest35U35_506583763e-25317 - 37610060 / 60plus
Harvest35U35_505615623e-25390 - 44910060 / 60plus
Harvest35U35_505285603e-25376 - 43510060 / 60plus
Harvest35U35_381745533e-25472 - 53110060 / 60plus
Harvest35U35_372165223e-25189 - 24810060 / 60plus
Harvest35U35_372145513e-25341 - 40010060 / 60plus
Harvest35U35_371435413e-25301 - 36010060 / 60plus
Harvest35U35_3296173e-25344 - 40310060 / 60plus
Harvest35U35_31412353e-25586 - 64510060 / 60plus
Harvest35U35_3056373e-25261 - 32010060 / 60plus
Harvest35U35_1106333e-25365 - 42410060 / 60plus
Harvest35U35_1096303e-25363 - 42210060 / 60plus
Harvest35U35_1066713e-25329 - 38810060 / 60plus
Harvest35U35_1056493e-25528 - 58710060 / 60plus
Harvest35U35_689553e-25404 - 46310060 / 60plus
Harvest35U35_78283e-25423 - 48210060 / 60plus
Harvest35U35_458885681e-23493 - 5529859 / 60plus
Harvest35U35_451115121e-23169 - 2289859 / 60plus
Harvest35U35_296006051e-23252 - 3119859 / 60plus
Harvest35U35_3158781e-23688 - 7479859 / 60plus
Harvest35U35_30210801e-23688 - 7479859 / 60plus
Harvest35U35_2276611e-23325 - 3849859 / 60plus
Harvest35U35_2079051e-23243 - 3029859 / 60plus
Harvest35U35_2047061e-23191 - 2509859 / 60plus
Harvest35U35_2035831e-23371 - 4309859 / 60plus
Harvest35U35_1966851e-23279 - 3389859 / 60plus
Harvest35U35_1157111e-23225 - 2849859 / 60plus
Harvest35U35_236346e-22260 - 3169856 / 57plus
Harvest35U35_86786e-22330 - 3869856 / 57plus



Contig Sequence (376 bp)

>U35_50658 376 Hv_44K_v2
CCGGAGGAGGTGTTCCCGGGTTGCCATAAGGATGTGATGAAGCTCTTGGTTGCATGCGTG
CCTGCGCTCTGCAATGTCCCCATTCCCAACGAGGCGGTAGGCACCAGAGGGGTCTGCTAC
TGGTCAGCGTCTACGGACACCTAGTCAAGCGATTATTATGCTTTTTAATAATTTGTGTGG
TGTGCGTGCGCGCGCACAACATGAATAACCTGATCTCCTGGTGTCCCTTCCCATCACAAC
AACCATTTCCACAACAACCACCATTTTGGCAACAACAACCAGTTCTATCGCAGCAACAAC
CATGTACACAAGAACAAACACCACTCCTACAAGAACAACAAGATCAAATGCTTCTGCAAG
TACAAATACCATTTGT



Homology of Contig U35_50658 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None