Probe Details

Probe IDChipProbe Sequence (60 bp)Probe locationDifferentially Expressed
CUST_13646_PI390587928Hv_44K_v2AATGTCACAACGTATTGCAAGGTCCCAAATGTTGCAACAGAGCAGTTGCCATGTGTTGCA816GeneList: black
MasterList: Hordein_Function_Probe_Module



Probe Values

3 dpa4 dpa5 dpa6 dpa7 dpa8 dpa
Normalized 0.0140.0110.1602.5785.0558.102
Raw 15.76915.327365.9408575.0036024.53310636.277



Probe Sequence's BLAST hits in Barley Unigene Datasets

DatasetHitHit LengthE-valuePosition on Hit% IdentityMatchDirectionProbes on Sequence
MLOCMLOC_27672.12362e-243 - 6210060 / 60plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
MLOCMLOC_28499.13217e-2373 - 1329859 / 60plus ABC00069 ABC00241 ABC00282 ABC00301 ABC00502 ABC00516 ABC00523 ABC00524 ABC00530 ABC00540 ABC00549 ABC00567 ABC00585 ABC00765 ABC00785 ABC00793 ABC00815 ABC00822 ABC53012
JLOC1JLOC1_18660.12368e-253 - 6210060 / 60plus
JLOC1JLOC1_19111.13214e-2373 - 1329859 / 60plus
Harvest21ABC005636503e-25353 - 41210060 / 60plus
Harvest21ABC005525353e-25390 - 44910060 / 60plus
Harvest21ABC005498683e-25320 - 37910060 / 60plusABC00549
Harvest21ABC005125433e-25483 - 54210060 / 60plus
Harvest21ABC002896223e-25494 - 55310060 / 60plus
Harvest21ABC002465973e-25471 - 53010060 / 60plus
Harvest21ABC452964541e-23373 - 4329859 / 60plus
Harvest21ABC450546611e-23454 - 5139859 / 60plus
Harvest21ABC438506001e-23327 - 3869859 / 60plus
Harvest21ABC438381971e-23129 - 1889859 / 60plus
Harvest21ABC435994571e-23374 - 4339859 / 60plus
Harvest21ABC435664821e-23414 - 4739859 / 60plus
Harvest21ABC435565121e-23298 - 3579859 / 60plus
Harvest21ABC344846761e-23208 - 2679859 / 60plus
Harvest21ABC344377301e-23496 - 5559859 / 60plus
Harvest21ABC343026921e-23430 - 4899859 / 60plus
Harvest21ABC342996781e-23243 - 3029859 / 60plus
Harvest21ABC340336321e-23160 - 2199859 / 60plus
Harvest21ABC331065281e-23460 - 5199859 / 60plus
Harvest21ABC330426601e-23488 - 5479859 / 60plus
Harvest21ABC328325081e-23297 - 3569859 / 60plus
Harvest21ABC326526281e-23472 - 5319859 / 60plus
Harvest21ABC322704681e-23253 - 3129859 / 60plus
Harvest21ABC298376811e-23374 - 4339859 / 60plus
Harvest21ABC298296341e-23386 - 4459859 / 60plus
Harvest21ABC0078111721e-23561 - 6209859 / 60plus
Harvest21ABC007726621e-23450 - 5099859 / 60plus
Harvest21ABC0076512401e-23694 - 7539859 / 60plusABC00765
Harvest21ABC007618321e-23582 - 6419859 / 60plus
Harvest21ABC005745021e-23363 - 4229859 / 60plus
Harvest21ABC005345451e-23373 - 4329859 / 60plus
Harvest21ABC005317041e-23320 - 3799859 / 60plus
Harvest21ABC0053010961e-23500 - 5599859 / 60plusABC00530
Harvest21ABC0052312351e-23625 - 6849859 / 60plusABC00523
Harvest21ABC0050612021e-23597 - 6569859 / 60plus
Harvest21ABC005056201e-23407 - 4669859 / 60plus
Harvest21ABC003044371e-23294 - 3539859 / 60plus
Harvest21ABC003027131e-23358 - 4179859 / 60plus
Harvest21ABC0025910111e-23411 - 4709859 / 60plus
Harvest21ABC002565911e-23453 - 5129859 / 60plus
Harvest21ABC002446201e-23476 - 5359859 / 60plus
Harvest21ABC000225051e-23398 - 4579859 / 60plus
Harvest21ABC326004212e-22353 - 4129758 / 60plus
Harvest21ABC002485472e-22473 - 5329758 / 60plus
Harvest21ABC437355716e-22207 - 2669758 / 60plus
Harvest21ABC344976616e-22499 - 5589758 / 60plus
Harvest21ABC343247116e-22354 - 4139758 / 60plus
Harvest21ABC329315226e-22318 - 3779758 / 60plus
Harvest21ABC329295516e-22470 - 5299758 / 60plus
Harvest21ABC328045416e-22430 - 4899758 / 60plus
Harvest21ABC327365536e-22497 - 5539856 / 57plus
Harvest21ABC289566056e-22381 - 4409758 / 60plus
Harvest21ABC007996816e-22404 - 4639758 / 60plus
Harvest21ABC0079310916e-22480 - 5399758 / 60plusABC00793
Harvest21ABC007916316e-22492 - 5519758 / 60plus
Harvest21ABC007838016e-22404 - 4639758 / 60plus
Harvest21ABC007606376e-22390 - 4499758 / 60plus
Harvest21ABC007576056e-22244 - 3039758 / 60plus
Harvest21ABC007558746e-22667 - 7269758 / 60plus
Harvest21ABC0030510306e-22474 - 5339758 / 60plus
Harvest21ABC003019706e-22366 - 4259758 / 60plusABC00301
Harvest21ABC002876306e-22492 - 5519758 / 60plus
Harvest21ABC002836716e-22458 - 5179758 / 60plus
Harvest21ABC002475806e-22467 - 5269758 / 60plus
Harvest21ABC0021115156e-22587 - 6469758 / 60plus
Harvest35U35_3158783e-25817 - 87610060 / 60plus
Harvest35U35_2047063e-25320 - 37910060 / 60plus
Harvest35U35_1157113e-25354 - 41310060 / 60plus
Harvest35U35_451174821e-23414 - 4739859 / 60plus
Harvest35U35_451115121e-23298 - 3579859 / 60plus
Harvest35U35_384577301e-23496 - 5559859 / 60plus
Harvest35U35_383606921e-23430 - 4899859 / 60plus
Harvest35U35_383576781e-23243 - 3029859 / 60plus
Harvest35U35_381766321e-23160 - 2199859 / 60plus
Harvest35U35_373175281e-23460 - 5199859 / 60plus
Harvest35U35_372806601e-23488 - 5479859 / 60plus
Harvest35U35_371595081e-23297 - 3569859 / 60plus
Harvest35U35_3296171e-23473 - 5329859 / 60plus
Harvest35U35_3189771e-23509 - 5689859 / 60plus
Harvest35U35_2276611e-23454 - 5139859 / 60plus
Harvest35U35_2079051e-23372 - 4319859 / 60plus
Harvest35U35_2066021e-23329 - 3889859 / 60plus
Harvest35U35_2035831e-23500 - 5599859 / 60plus
Harvest35U35_19712061e-23597 - 6569859 / 60plus
Harvest35U35_1966851e-23408 - 4679859 / 60plus
Harvest35U35_887201e-23411 - 4709859 / 60plus
Harvest35U35_776331e-23477 - 5369859 / 60plus
Harvest35U35_247291e-23374 - 4339859 / 60plus
Harvest35U35_236341e-23386 - 4459859 / 60plus
Harvest35U35_86781e-23456 - 5159859 / 60plus
Harvest35U35_505626376e-22450 - 5099758 / 60plus
Harvest35U35_452055716e-22207 - 2669758 / 60plus
Harvest35U35_385006616e-22499 - 5589758 / 60plus
Harvest35U35_372165226e-22318 - 3779758 / 60plus
Harvest35U35_372145516e-22470 - 5299758 / 60plus
Harvest35U35_371435416e-22430 - 4899758 / 60plus
Harvest35U35_371025536e-22497 - 5539856 / 57plus
Harvest35U35_296006056e-22381 - 4409758 / 60plus
Harvest35U35_31412356e-22715 - 7749758 / 60plus
Harvest35U35_3056376e-22390 - 4499758 / 60plus
Harvest35U35_3036056e-22244 - 3039758 / 60plus
Harvest35U35_30210806e-22817 - 8769758 / 60plus
Harvest35U35_1106336e-22494 - 5539758 / 60plus
Harvest35U35_1096306e-22492 - 5519758 / 60plus
Harvest35U35_1066716e-22458 - 5179758 / 60plus
Harvest35U35_689556e-22533 - 5929758 / 60plus
Harvest35U35_78286e-22552 - 6119758 / 60plus



Contig Sequence (878 bp)

>U35_315 878 Hv_44K_v2
AAACCAAGCAACACTAGTTAACACCAATCCACCATGAAGACCTTCCTCATCTTTGCACTC
CTGGCCATTGCGGCAACAAGTACGATTGCGCAGCAACAACCACTTCCGCAACAACCCATC
CCACAAAAACCACAACCATACCCACAACAACCCTTCCCACCGCAACAACCATTTCCACAA
CAACCCGTCCCACAACAACCACAACCATACCCACAACAACCACAACAACCCTTCCCACCG
CAACAACCATTTCCACAACAACCACCATTTGGGTTACAACAACCCATCCCACAACAACCA
CAACCATACCCACAACAACCACAACCATATCCACAACAACCCTTCCCACCGCAACAACCA
TTTCCACAACAACCCATCCCACAACAACCACAACCATACCCACAACAACCACAACCATAT
CCACAACAACCCTTCCCACCGCAACAAGAATTTCCACAACAACCATCATTTTGGCCACAA
CAACCATTTCCACAGCAACCACCATTTGGGCTACAACAACCAATTCTATCCGCAACAACC
CATCCCACAACAACCACAACCATACCCACAACAACCACAACCATTTCCACAACAACCCTT
CCCATCACAACAACCATTTCCACAACAACCACCATTTTGGCAACAACAACCAGTTCTATC
GCAGCAACAACCATGTACACAAGACCAAACACCACTCCTACAAGAACAACAAGATCAAAT
GCTTGTGCAAGTACAAATACCATTTGTTCATCCATCTATTTTGCAGCAGCTAAACCCATG
CAAGGTATTCCTCCAGCAGCAGTGCAGCCCTGTGGCAATGTCACAACGTATTGCAAGGTC
CCAAATGTTGCAACAGAGCAGTTGCCATGTGTTGCAGC



Homology of Contig U35_315 to Model Species (E-value threshold 1e-50)

Pseudo-peptide datasetHitHit lengthE-valueDescription
Rice v7None
Brachypodium v1_2None
Arabidopsis v10None