Probe CUST_5839_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_5839_PI426222305 | JHI_St_60k_v1 | DMT400007060 | GACCCTTCTTCTGTTACTGGATGATGAAAATATTGTACAATACTATCAGGAACTAAGCTA |
All Microarray Probes Designed to Gene DMG400002728
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_5839_PI426222305 | JHI_St_60k_v1 | DMT400007060 | GACCCTTCTTCTGTTACTGGATGATGAAAATATTGTACAATACTATCAGGAACTAAGCTA |
Microarray Signals from CUST_5839_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 1616.17 | 241.711 | 1.949 | 0.190399 |
| ABA 1h | 1186.23 | 70.086 | 1.64531 | 0.0950767 |
| ACC 1h | 1184.21 | 185.458 | 1.38086 | 0.13441 |
| BABA 1h | 936.587 | 217.551 | 1.11688 | 0.19518 |
| Chitin 1h | 653.525 | 66.1355 | 0.885268 | 0.10379 |
| Epi 1h | 835.566 | 171.507 | 1.12918 | 0.258128 |
| SA 1h | 956.207 | 116.546 | 1.12902 | 0.126962 |
| Me-JA 1h | 458.517 | 54.641 | 0.681887 | 0.0396372 |
| Control 6h | 854.42 | 301.241 | 0.895908 | 0.332234 |
| ABA 6h | 909.133 | 78.7543 | 1.04499 | 0.0604487 |
| ACC 6h | 869.773 | 195.346 | 0.877189 | 0.170479 |
| BABA 6h | 888.751 | 165.322 | 0.943983 | 0.157983 |
| Chitin 6h | 859.499 | 49.8496 | 0.992126 | 0.0574167 |
| Epi 6h | 804.935 | 64.2488 | 0.873551 | 0.0669708 |
| SA 6h | 776.122 | 144.043 | 0.928962 | 0.0841338 |
| Me-JA 6h | 497.985 | 133.895 | 0.564705 | 0.130498 |
Source Transcript PGSC0003DMT400007060 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT3G10040.1 | +3 | 6e-72 | 233 | 139/287 (48%) | sequence-specific DNA binding transcription factors | chr3:3096580-3097875 REVERSE LENGTH=431 |