Probe CUST_5574_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_5574_PI426222305 | JHI_St_60k_v1 | DMT400006868 | TACTTCACCTACGGTCGTCATCTCTACATCTACAACTGGATAATATCTACAACTGGATAA |
All Microarray Probes Designed to Gene DMG400002667
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_5574_PI426222305 | JHI_St_60k_v1 | DMT400006868 | TACTTCACCTACGGTCGTCATCTCTACATCTACAACTGGATAATATCTACAACTGGATAA |
Microarray Signals from CUST_5574_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 7.41802 | 3.22468 | 0.665774 | 0.30487 |
| ABA 1h | 9.67029 | 3.10297 | 0.937656 | 0.359956 |
| ACC 1h | 7.84964 | 3.48151 | 0.67284 | 0.330404 |
| BABA 1h | 7.36627 | 3.37918 | 0.683803 | 0.329648 |
| Chitin 1h | 6.26313 | 3.21976 | 0.638417 | 0.332495 |
| Epi 1h | 8.96506 | 3.24094 | 0.850093 | 0.378942 |
| SA 1h | 16.3117 | 3.25082 | 1.45902 | 0.291697 |
| Me-JA 1h | 5.58883 | 3.25508 | 0.62911 | 0.364612 |
| Control 6h | 20.9853 | 6.26817 | 1.74091 | 0.469571 |
| ABA 6h | 11.7745 | 3.60388 | 1.00273 | 0.321246 |
| ACC 6h | 23.9573 | 11.8301 | 1.53957 | 0.536944 |
| BABA 6h | 20.3568 | 8.30212 | 1.37964 | 0.795237 |
| Chitin 6h | 20.5081 | 4.78952 | 1.69271 | 0.361299 |
| Epi 6h | 15.1764 | 4.01334 | 1.15676 | 0.447559 |
| SA 6h | 17.064 | 3.98927 | 1.48688 | 0.390284 |
| Me-JA 6h | 9.7841 | 3.43853 | 0.855218 | 0.341571 |
Source Transcript PGSC0003DMT400006868 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |