Probe CUST_5357_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_5357_PI426222305 | JHI_St_60k_v1 | DMT400003894 | GTCTCTTGCCAATGAAAATAGTATTGTATATCATAAGCATCCGAGTATTGTAGGACATGT |
All Microarray Probes Designed to Gene DMG400001536
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_5357_PI426222305 | JHI_St_60k_v1 | DMT400003894 | GTCTCTTGCCAATGAAAATAGTATTGTATATCATAAGCATCCGAGTATTGTAGGACATGT |
Microarray Signals from CUST_5357_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 5.4397 | 3.1549 | 0.899273 | 0.521295 |
| ABA 1h | 34.3115 | 4.85846 | 6.27357 | 0.707062 |
| ACC 1h | 6.37444 | 3.46211 | 1.02073 | 0.558156 |
| BABA 1h | 5.83638 | 3.38255 | 1.00101 | 0.579891 |
| Chitin 1h | 5.57249 | 3.23761 | 1.02478 | 0.591495 |
| Epi 1h | 6.47176 | 3.21631 | 1.21906 | 0.626324 |
| SA 1h | 5.99456 | 3.20194 | 0.960687 | 0.518576 |
| Me-JA 1h | 5.81251 | 3.29386 | 1.17647 | 0.665238 |
| Control 6h | 9.39295 | 3.42011 | 1.42736 | 0.611793 |
| ABA 6h | 74.2872 | 17.5661 | 10.9656 | 2.10868 |
| ACC 6h | 6.89239 | 4.09806 | 0.969053 | 0.561154 |
| BABA 6h | 6.51903 | 3.7846 | 0.96076 | 0.556358 |
| Chitin 6h | 9.21762 | 3.71642 | 1.30879 | 0.62738 |
| Epi 6h | 6.62098 | 3.86483 | 0.963568 | 0.558001 |
| SA 6h | 7.01646 | 3.54957 | 1.14857 | 0.601185 |
| Me-JA 6h | 5.83441 | 3.38136 | 0.968127 | 0.560603 |
Source Transcript PGSC0003DMT400003894 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT4G35690.1 | +3 | 2e-42 | 150 | 105/295 (36%) | Arabidopsis protein of unknown function (DUF241) | chr4:16921886-16922740 FORWARD LENGTH=284 |