Probe CUST_42680_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_42680_PI426222305 | JHI_St_60k_v1 | DMT400052335 | AATTTGACAAGGAGGGATAAGTACGCAATACTTGCTGGAACTGACGGTCGCGTTGCAATA |
All Microarray Probes Designed to Gene DMG400020315
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_42680_PI426222305 | JHI_St_60k_v1 | DMT400052335 | AATTTGACAAGGAGGGATAAGTACGCAATACTTGCTGGAACTGACGGTCGCGTTGCAATA |
Microarray Signals from CUST_42680_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 28283.9 | 2496.87 | 2.71665 | 0.156846 |
ABA 1h | 12864.5 | 3145.55 | 1.32943 | 0.401749 |
ACC 1h | 27946.2 | 10180.6 | 2.23931 | 0.851691 |
BABA 1h | 13147.2 | 1049.86 | 1.31181 | 0.148812 |
Chitin 1h | 12849.7 | 2314.7 | 1.33875 | 0.317284 |
Epi 1h | 13908.5 | 804.071 | 1.55303 | 0.0896651 |
SA 1h | 18286.6 | 4432.29 | 1.61773 | 0.506646 |
Me-JA 1h | 8872.73 | 1341.45 | 1.02457 | 0.265248 |
Control 6h | 9461.37 | 3796.44 | 0.666561 | 0.477084 |
ABA 6h | 2101.15 | 1346.45 | 0.124365 | 0.126635 |
ACC 6h | 4162.81 | 1141.37 | 0.317053 | 0.105359 |
BABA 6h | 5879.06 | 1545.46 | 0.469498 | 0.128871 |
Chitin 6h | 7393.6 | 2292.97 | 0.605954 | 0.204874 |
Epi 6h | 8856.25 | 2651.58 | 0.688102 | 0.28024 |
SA 6h | 4142.28 | 1369.31 | 0.358946 | 0.197501 |
Me-JA 6h | 1902.32 | 921.292 | 0.148785 | 0.0653025 |
Source Transcript PGSC0003DMT400052335 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT2G38110.1 | +1 | 0.0 | 723 | 377/490 (77%) | glycerol-3-phosphate acyltransferase 6 | chr2:15952816-15955364 REVERSE LENGTH=501 |