Probe CUST_42451_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_42451_PI426222305 | JHI_St_60k_v1 | DMT400059172 | CATGCATTTAGACCAGAACACGAGAATGTAGAAACATGCATACTTTATATGAACAACTGA |
All Microarray Probes Designed to Gene DMG401022984
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_42451_PI426222305 | JHI_St_60k_v1 | DMT400059172 | CATGCATTTAGACCAGAACACGAGAATGTAGAAACATGCATACTTTATATGAACAACTGA |
Microarray Signals from CUST_42451_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 11.0946 | 3.68465 | 0.305455 | 0.118095 |
ABA 1h | 39.9034 | 8.2141 | 1.26434 | 0.235384 |
ACC 1h | 11.4334 | 4.54013 | 0.324485 | 0.131479 |
BABA 1h | 37.016 | 4.4152 | 1.11275 | 0.134027 |
Chitin 1h | 21.3354 | 3.82366 | 0.673403 | 0.14697 |
Epi 1h | 14.2721 | 3.61038 | 0.46069 | 0.12602 |
SA 1h | 18.3419 | 10.6212 | 0.374338 | 0.243636 |
Me-JA 1h | 31.5638 | 14.1184 | 0.807159 | 0.818056 |
Control 6h | 51.5947 | 12.4412 | 1.42031 | 0.411179 |
ABA 6h | 25.1985 | 6.16787 | 0.656422 | 0.196974 |
ACC 6h | 272.976 | 237.781 | 2.40999 | 8.0518 |
BABA 6h | 44.9099 | 12.5939 | 1.08493 | 0.295248 |
Chitin 6h | 52.0016 | 10.6522 | 1.37459 | 0.230501 |
Epi 6h | 49.5314 | 5.30794 | 1.28267 | 0.137653 |
SA 6h | 58.4943 | 5.28921 | 1.72919 | 0.261176 |
Me-JA 6h | 57.1261 | 9.46406 | 1.6285 | 0.202612 |
Source Transcript PGSC0003DMT400059172 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT1G30260.1 | +3 | 6e-12 | 62 | 28/39 (72%) | BEST Arabidopsis thaliana protein match is: Galactosyltransferase family protein (TAIR:AT4G21060.1); Has 30 Blast hits to 30 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:10651159-10651452 FORWARD LENGTH=97 |