Probe CUST_42124_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_42124_PI426222305 | JHI_St_60k_v1 | DMT400050493 | CTTGATAAAAAATAGCGACGGGCAACTTCTGTCGTTAAACAACAAAAATTCAAAATAGGG |
All Microarray Probes Designed to Gene DMG400019623
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_42124_PI426222305 | JHI_St_60k_v1 | DMT400050493 | CTTGATAAAAAATAGCGACGGGCAACTTCTGTCGTTAAACAACAAAAATTCAAAATAGGG |
Microarray Signals from CUST_42124_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 192.008 | 19.9813 | 2.57832 | 0.156157 |
ABA 1h | 55.9751 | 4.63373 | 0.857811 | 0.0818896 |
ACC 1h | 150.261 | 35.3325 | 1.86493 | 0.363527 |
BABA 1h | 206.896 | 43.5901 | 2.77033 | 0.37084 |
Chitin 1h | 263.505 | 15.6129 | 3.97119 | 0.234962 |
Epi 1h | 168.721 | 13.6079 | 2.62769 | 0.289425 |
SA 1h | 293.561 | 95.4965 | 3.52421 | 0.903927 |
Me-JA 1h | 87.3224 | 22.349 | 1.35432 | 0.250267 |
Control 6h | 58.3115 | 11.9441 | 0.751661 | 0.109829 |
ABA 6h | 14.6641 | 3.74496 | 0.173466 | 0.0523885 |
ACC 6h | 70.973 | 10.5573 | 0.820167 | 0.0984654 |
BABA 6h | 64.493 | 5.4472 | 0.776589 | 0.0649602 |
Chitin 6h | 75.9364 | 12.7093 | 0.937231 | 0.151533 |
Epi 6h | 62.9933 | 11.8379 | 0.729112 | 0.114061 |
SA 6h | 32.931 | 4.15621 | 0.447342 | 0.0577347 |
Me-JA 6h | 28.8163 | 3.87763 | 0.39017 | 0.0528449 |
Source Transcript PGSC0003DMT400050493 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT2G35930.1 | +1 | 6e-146 | 426 | 209/406 (51%) | plant U-box 23 | chr2:15083101-15084336 REVERSE LENGTH=411 |