Probe CUST_415_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_415_PI426222305 | JHI_St_60k_v1 | DMT400024250 | CTGTGCTCTCTTATGCTGTCAAATTTTCTTCACTAATCTGGGTTTTGTATTTTGGGATTA |
All Microarray Probes Designed to Gene DMG400009365
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_415_PI426222305 | JHI_St_60k_v1 | DMT400024250 | CTGTGCTCTCTTATGCTGTCAAATTTTCTTCACTAATCTGGGTTTTGTATTTTGGGATTA |
Microarray Signals from CUST_415_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 98.1063 | 17.6803 | 0.843938 | 0.156019 |
| ABA 1h | 85.4907 | 15.6504 | 0.831007 | 0.104839 |
| ACC 1h | 254.566 | 40.0536 | 2.1545 | 0.196436 |
| BABA 1h | 160.499 | 37.1664 | 1.39446 | 0.225235 |
| Chitin 1h | 159.164 | 9.71735 | 1.57219 | 0.0956612 |
| Epi 1h | 118.247 | 16.3331 | 1.19177 | 0.164308 |
| SA 1h | 153.08 | 35.1969 | 1.26005 | 0.263492 |
| Me-JA 1h | 46.0817 | 8.47483 | 0.483264 | 0.070702 |
| Control 6h | 81.4328 | 26.2993 | 0.62883 | 0.214037 |
| ABA 6h | 315.34 | 72.3713 | 2.51714 | 0.419382 |
| ACC 6h | 244.554 | 14.6767 | 1.89325 | 0.175002 |
| BABA 6h | 202.834 | 96.115 | 1.31447 | 0.609176 |
| Chitin 6h | 74.8148 | 22.6027 | 0.576412 | 0.170361 |
| Epi 6h | 100.936 | 10.8709 | 0.789183 | 0.0933866 |
| SA 6h | 70.1917 | 21.2836 | 0.556759 | 0.156206 |
| Me-JA 6h | 59.5016 | 13.3421 | 0.503491 | 0.0986019 |
Source Transcript PGSC0003DMT400024250 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | Solyc04g076220.2 | +1 | 9e-143 | 416 | 288/345 (83%) | genomic_reference:SL2.50ch04 gene_region:58757542-58758976 transcript_region:SL2.50ch04:58757542..58758976+ functional_description:AT-hook motif nuclear localized protein 17 (AHRD V1 **-- Q9LTA2_ARATH); contains Interpro domain(s) IPR014476 Predicted AT-hook DNA-binding |
| TAIR PP10 | AT5G49700.1 | +1 | 4e-63 | 209 | 113/201 (56%) | Predicted AT-hook DNA-binding family protein | chr5:20192599-20193429 FORWARD LENGTH=276 |