Probe CUST_40608_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_40608_PI426222305 JHI_St_60k_v1 DMT400073980 TCGGAGAAGTGAGTCTGATCTACAAGAAAAAATTTAGGTGTGAAGTTTGTATAGCTCATG

All Microarray Probes Designed to Gene DMG400028750

Probe IDChip nameTranscript IDProbe Sequence
CUST_40608_PI426222305 JHI_St_60k_v1 DMT400073980 TCGGAGAAGTGAGTCTGATCTACAAGAAAAAATTTAGGTGTGAAGTTTGTATAGCTCATG


Microarray Signals from CUST_40608_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h39.86329.555821.030280.192823
ABA 1h5.507453.060270.1708450.0949799
ACC 1h59.230920.02311.382490.473087
BABA 1h86.487130.28092.014340.897418
Chitin 1h51.163316.49971.407470.35849
Epi 1h64.5434.847832.047170.153801
SA 1h55.850211.08851.426880.231552
Me-JA 1h59.777719.05131.831130.455221
Control 6h21.71083.983190.5761210.103919
ABA 6h10.41774.404480.2286090.103567
ACC 6h41.13424.644070.9835020.155038
BABA 6h28.06317.966930.6190540.20432
Chitin 6h32.092614.070.692740.298065
Epi 6h33.88544.27410.8241980.103412
SA 6h36.732611.70850.8786970.283164
Me-JA 6h39.52954.056921.087590.111936

Source Transcript PGSC0003DMT400073980 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G29195.1 +3 5e-06 46 41/173 (24%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, 4 leaf senescence stage, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30230.1); Has 180 Blast hits to 180 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 180; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:10202673-10203254 REVERSE LENGTH=193

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073980

Click here to view details at Spud DB Genome Browser (opens in new window)