Probe CUST_39548_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_39548_PI426222305 | JHI_St_60k_v1 | DMT400068728 | GCAACTATAGAGGCTTTGATTTGATCTTCTTGCAAAATGACAAGTGTTCCAAGCTTTTTT |
All Microarray Probes Designed to Gene DMG400026724
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_39548_PI426222305 | JHI_St_60k_v1 | DMT400068728 | GCAACTATAGAGGCTTTGATTTGATCTTCTTGCAAAATGACAAGTGTTCCAAGCTTTTTT |
Microarray Signals from CUST_39548_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 12.6126 | 2.95463 | 0.979249 | 0.233817 |
| ABA 1h | 13.6082 | 6.47747 | 0.98105 | 0.51889 |
| ACC 1h | 70.4719 | 30.8016 | 4.0063 | 2.64537 |
| BABA 1h | 19.3349 | 4.11261 | 1.50936 | 0.279558 |
| Chitin 1h | 8.42266 | 2.90577 | 0.700956 | 0.278839 |
| Epi 1h | 16.9301 | 5.88051 | 1.26306 | 0.722661 |
| SA 1h | 10.717 | 3.10092 | 0.740859 | 0.309897 |
| Me-JA 1h | 7.94134 | 2.98092 | 0.7341 | 0.306157 |
| Control 6h | 8.09438 | 2.98395 | 0.597463 | 0.252157 |
| ABA 6h | 127.394 | 33.9194 | 8.63346 | 3.03081 |
| ACC 6h | 102.997 | 13.9066 | 6.90795 | 0.944178 |
| BABA 6h | 17.3544 | 8.8898 | 0.920085 | 0.593872 |
| Chitin 6h | 20.9867 | 10.3052 | 1.16197 | 0.916506 |
| Epi 6h | 10.0654 | 3.4866 | 0.659035 | 0.261623 |
| SA 6h | 9.49697 | 3.19462 | 0.704799 | 0.288394 |
| Me-JA 6h | 7.19011 | 2.99188 | 0.530417 | 0.252695 |
Source Transcript PGSC0003DMT400068728 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT4G35070.1 | +2 | 1e-53 | 181 | 97/191 (51%) | SBP (S-ribonuclease binding protein) family protein | chr4:16694488-16695387 FORWARD LENGTH=265 |