Probe CUST_38319_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_38319_PI426222305 JHI_St_60k_v1 DMT400043661 GAGAGTTTTCGTTATGGCTATGAATCTTGAATTTCATATGGCAAAGGAGTATTCATTTGC

All Microarray Probes Designed to Gene DMG400016956

Probe IDChip nameTranscript IDProbe Sequence
CUST_38319_PI426222305 JHI_St_60k_v1 DMT400043661 GAGAGTTTTCGTTATGGCTATGAATCTTGAATTTCATATGGCAAAGGAGTATTCATTTGC


Microarray Signals from CUST_38319_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h36.77049.930541.109070.291091
ABA 1h35.84849.497981.211920.336453
ACC 1h32.397513.90770.7206730.603802
BABA 1h37.47549.251131.173670.222789
Chitin 1h27.11148.248180.8896770.220484
Epi 1h28.42475.245621.031710.196197
SA 1h57.6486.069821.804560.141173
Me-JA 1h48.21989.950941.842660.319113
Control 6h26.29737.480090.7891550.162474
ABA 6h71.241915.77542.072640.3633
ACC 6h26.49364.029550.7386260.110689
BABA 6h33.46273.975670.9680780.115096
Chitin 6h23.94433.662710.7234430.113854
Epi 6h18.90263.69010.53940.105091
SA 6h16.81734.551660.5132350.125489
Me-JA 6h33.52946.43451.059060.123558

Source Transcript PGSC0003DMT400043661 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G71780.1 +1 5e-59 190 93/159 (58%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:26995406-26996638 REVERSE LENGTH=197

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400043661

Click here to view details at Spud DB Genome Browser (opens in new window)