Probe CUST_38296_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_38296_PI426222305 | JHI_St_60k_v1 | DMT400067363 | CCAGGAATCAGTAATGGAGGAGTTAAGGATAATGTTAACAATACCTCTAATGGCAAAGCT |
All Microarray Probes Designed to Gene DMG400026193
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_38296_PI426222305 | JHI_St_60k_v1 | DMT400067363 | CCAGGAATCAGTAATGGAGGAGTTAAGGATAATGTTAACAATACCTCTAATGGCAAAGCT |
Microarray Signals from CUST_38296_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 487.442 | 132.732 | 1.503 | 0.301056 |
ABA 1h | 298.917 | 74.8866 | 1.05077 | 0.181994 |
ACC 1h | 423.292 | 79.9984 | 1.315 | 0.208579 |
BABA 1h | 389.576 | 64.8643 | 1.2904 | 0.102885 |
Chitin 1h | 276.014 | 28.6651 | 1.00065 | 0.112691 |
Epi 1h | 273.906 | 60.0996 | 0.982871 | 0.245733 |
SA 1h | 459.811 | 26.8187 | 1.47331 | 0.0857965 |
Me-JA 1h | 1794.19 | 277.47 | 7.08038 | 0.470147 |
Control 6h | 286.875 | 87.6853 | 0.828846 | 0.26398 |
ABA 6h | 209.235 | 34.5107 | 0.629506 | 0.0810365 |
ACC 6h | 217.457 | 27.2832 | 0.614426 | 0.0537676 |
BABA 6h | 235.624 | 40.7641 | 0.670216 | 0.105112 |
Chitin 6h | 199.318 | 12.2549 | 0.615254 | 0.0377511 |
Epi 6h | 201.889 | 40.1473 | 0.568903 | 0.124731 |
SA 6h | 211.36 | 48.6622 | 0.659107 | 0.102856 |
Me-JA 6h | 371.052 | 38.9763 | 1.21404 | 0.076682 |
Source Transcript PGSC0003DMT400067363 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT4G00390.1 | +1 | 1e-13 | 69 | 43/89 (48%) | DNA-binding storekeeper protein-related transcriptional regulator | chr4:171650-172744 REVERSE LENGTH=364 |