Probe CUST_38277_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_38277_PI426222305 | JHI_St_60k_v1 | DMT400067384 | GTTTCGGTGGAGTTTTAGATTTTGTTTCATAGTCTTGTTTCTCAAGACAATTTCTTCTCG |
All Microarray Probes Designed to Gene DMG400026196
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_38277_PI426222305 | JHI_St_60k_v1 | DMT400067384 | GTTTCGGTGGAGTTTTAGATTTTGTTTCATAGTCTTGTTTCTCAAGACAATTTCTTCTCG |
Microarray Signals from CUST_38277_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 1147.92 | 227.407 | 1.10132 | 0.156039 |
| ABA 1h | 911.207 | 216.762 | 0.968715 | 0.164966 |
| ACC 1h | 935.129 | 169.874 | 0.876091 | 0.114683 |
| BABA 1h | 1170.44 | 232.724 | 1.152 | 0.141494 |
| Chitin 1h | 758.714 | 87.9463 | 0.828178 | 0.0844209 |
| Epi 1h | 832.44 | 142.624 | 0.926203 | 0.154957 |
| SA 1h | 1291.97 | 106.87 | 1.24226 | 0.14991 |
| Me-JA 1h | 4173.76 | 241.382 | 5.07789 | 0.293206 |
| Control 6h | 1118.11 | 288.455 | 1.02286 | 0.226022 |
| ABA 6h | 1072.58 | 162.385 | 0.982531 | 0.0961327 |
| ACC 6h | 1083.48 | 162.6 | 0.919819 | 0.0532502 |
| BABA 6h | 1154.99 | 99.0798 | 1.01844 | 0.0589226 |
| Chitin 6h | 1029.07 | 59.5811 | 0.961472 | 0.0556522 |
| Epi 6h | 1005.75 | 58.3314 | 0.886055 | 0.0681347 |
| SA 6h | 913.533 | 263.847 | 0.818469 | 0.211118 |
| Me-JA 6h | 1149.93 | 132.316 | 1.13242 | 0.0654954 |
Source Transcript PGSC0003DMT400067384 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT4G00390.1 | +3 | 5e-20 | 92 | 51/112 (46%) | DNA-binding storekeeper protein-related transcriptional regulator | chr4:171650-172744 REVERSE LENGTH=364 |