Probe CUST_38235_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_38235_PI426222305 | JHI_St_60k_v1 | DMT400067419 | CTGGTGGATCATTTTCTATTGGATGCTACAAGTTTTGATACTGTTTCGGTTGAGTCTTAG |
All Microarray Probes Designed to Gene DMG400026206
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_38235_PI426222305 | JHI_St_60k_v1 | DMT400067419 | CTGGTGGATCATTTTCTATTGGATGCTACAAGTTTTGATACTGTTTCGGTTGAGTCTTAG |
Microarray Signals from CUST_38235_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 887.06 | 110.1 | 1.00863 | 0.0718227 |
| ABA 1h | 680.491 | 112.357 | 0.861215 | 0.0971984 |
| ACC 1h | 751.532 | 143.363 | 0.8124 | 0.112969 |
| BABA 1h | 906.823 | 149.373 | 1.05187 | 0.0824346 |
| Chitin 1h | 673.009 | 106.288 | 0.84363 | 0.0707562 |
| Epi 1h | 687.721 | 68.3009 | 0.906935 | 0.0797247 |
| SA 1h | 866.599 | 68.6631 | 0.967337 | 0.0559668 |
| Me-JA 1h | 1823.8 | 203.258 | 2.54673 | 0.147107 |
| Control 6h | 1027.22 | 249.482 | 1.10124 | 0.218198 |
| ABA 6h | 992.576 | 118.617 | 1.06262 | 0.0778101 |
| ACC 6h | 979.299 | 130.264 | 0.968376 | 0.056033 |
| BABA 6h | 1018.76 | 66.5714 | 1.04532 | 0.0604693 |
| Chitin 6h | 902.914 | 72.3264 | 0.972021 | 0.0562586 |
| Epi 6h | 904.348 | 132.702 | 0.905759 | 0.113016 |
| SA 6h | 741.028 | 254.523 | 0.714478 | 0.289186 |
| Me-JA 6h | 924.245 | 109.419 | 1.05562 | 0.0610689 |
Source Transcript PGSC0003DMT400067419 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |