Probe CUST_37972_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_37972_PI426222305 | JHI_St_60k_v1 | DMT400081450 | GCTACATTAGATATGGTACACTACTATAGCAATATCCAACTTGTTGCTTCATTAGTTCTC |
All Microarray Probes Designed to Gene DMG400031849
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_37972_PI426222305 | JHI_St_60k_v1 | DMT400081450 | GCTACATTAGATATGGTACACTACTATAGCAATATCCAACTTGTTGCTTCATTAGTTCTC |
Microarray Signals from CUST_37972_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 6.20945 | 3.60493 | 0.718142 | 0.415852 |
| ABA 1h | 18.1763 | 10.6946 | 1.69009 | 1.23723 |
| ACC 1h | 7.87303 | 4.00412 | 0.850746 | 0.448414 |
| BABA 1h | 6.49744 | 3.7512 | 0.781399 | 0.451105 |
| Chitin 1h | 6.60158 | 3.58632 | 0.850765 | 0.462452 |
| Epi 1h | 6.03083 | 3.49625 | 0.806943 | 0.467277 |
| SA 1h | 6.98626 | 3.58961 | 0.778049 | 0.410288 |
| Me-JA 1h | 10.1863 | 4.13147 | 1.24645 | 0.587057 |
| Control 6h | 8.15204 | 3.65414 | 0.901336 | 0.444318 |
| ABA 6h | 823.562 | 237.194 | 80.0189 | 27.5494 |
| ACC 6h | 611.433 | 176.494 | 57.3193 | 23.2378 |
| BABA 6h | 1074.37 | 341.984 | 98.0138 | 40.9849 |
| Chitin 6h | 26.0316 | 9.14837 | 2.31337 | 1.54927 |
| Epi 6h | 11.854 | 4.41504 | 1.11755 | 0.48907 |
| SA 6h | 63.9953 | 28.7228 | 6.18039 | 4.30838 |
| Me-JA 6h | 14.5993 | 5.63597 | 1.4702 | 0.675883 |
Source Transcript PGSC0003DMT400081450 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT3G48690.1 | +3 | 3e-74 | 238 | 132/334 (40%) | alpha/beta-Hydrolases superfamily protein | chr3:18037186-18038160 REVERSE LENGTH=324 |