Probe CUST_37262_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_37262_PI426222305 | JHI_St_60k_v1 | DMT400019607 | CAAGCTCTTGATCTTTATGATGTTTTAGACTGCAAATCTATTGCTGCTCACATCAAGAAG |
All Microarray Probes Designed to Gene DMG400007577
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_37262_PI426222305 | JHI_St_60k_v1 | DMT400019607 | CAAGCTCTTGATCTTTATGATGTTTTAGACTGCAAATCTATTGCTGCTCACATCAAGAAG |
Microarray Signals from CUST_37262_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 186.035 | 25.2528 | 1.11902 | 0.0783233 |
ABA 1h | 93.4348 | 14.8793 | 0.632065 | 0.0663136 |
ACC 1h | 168.614 | 59.9859 | 0.823987 | 0.395492 |
BABA 1h | 120.792 | 12.5566 | 0.759997 | 0.0940049 |
Chitin 1h | 88.3734 | 11.8398 | 0.591722 | 0.0629554 |
Epi 1h | 113.464 | 11.4518 | 0.795573 | 0.0567013 |
SA 1h | 126.343 | 22.2635 | 0.731763 | 0.146383 |
Me-JA 1h | 46.5075 | 4.33611 | 0.348672 | 0.0324322 |
Control 6h | 320.158 | 113.506 | 1.65096 | 0.651924 |
ABA 6h | 351.234 | 68.8787 | 1.95239 | 0.491173 |
ACC 6h | 277.201 | 68.6295 | 1.39462 | 0.16165 |
BABA 6h | 313.466 | 39.2997 | 1.68941 | 0.146377 |
Chitin 6h | 294.254 | 54.6742 | 1.63498 | 0.294853 |
Epi 6h | 232.661 | 50.6664 | 1.21079 | 0.26833 |
SA 6h | 182.256 | 29.7513 | 1.09498 | 0.295133 |
Me-JA 6h | 135.029 | 24.2901 | 0.802266 | 0.115682 |
Source Transcript PGSC0003DMT400019607 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT3G16120.1 | +3 | 3e-46 | 155 | 72/92 (78%) | Dynein light chain type 1 family protein | chr3:5465035-5465395 FORWARD LENGTH=93 |