Probe CUST_37004_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_37004_PI426222305 | JHI_St_60k_v1 | DMT400068512 | GCATTCACAAGTTAACATAATCTCACTTCTATGTCTGCAACATCACTTATCACATCCTAT |
All Microarray Probes Designed to Gene DMG400026646
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_37004_PI426222305 | JHI_St_60k_v1 | DMT400068512 | GCATTCACAAGTTAACATAATCTCACTTCTATGTCTGCAACATCACTTATCACATCCTAT |
Microarray Signals from CUST_37004_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 1399.97 | 211.451 | 3.1948 | 0.280459 |
ABA 1h | 797.672 | 107.343 | 2.06263 | 0.258987 |
ACC 1h | 811.572 | 205.859 | 1.69264 | 0.404521 |
BABA 1h | 853.793 | 146.173 | 2.0023 | 0.1832 |
Chitin 1h | 734.838 | 42.5931 | 1.9039 | 0.129727 |
Epi 1h | 733.239 | 42.5389 | 1.9716 | 0.1142 |
SA 1h | 1451.23 | 84.0211 | 3.28665 | 0.18992 |
Me-JA 1h | 432.388 | 34.5358 | 1.22673 | 0.0715644 |
Control 6h | 315.641 | 60.8865 | 0.706737 | 0.0793916 |
ABA 6h | 154.122 | 28.1485 | 0.326798 | 0.0420463 |
ACC 6h | 201.576 | 39.0159 | 0.391462 | 0.0879754 |
BABA 6h | 263.38 | 26.8724 | 0.542923 | 0.0473911 |
Chitin 6h | 315.229 | 21.718 | 0.686904 | 0.065004 |
Epi 6h | 342.643 | 21.5388 | 0.705578 | 0.0783282 |
SA 6h | 233.734 | 29.1293 | 0.54136 | 0.032697 |
Me-JA 6h | 292.113 | 86.0537 | 0.626632 | 0.137407 |
Source Transcript PGSC0003DMT400068512 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT5G01550.1 | +1 | 0.0 | 626 | 329/658 (50%) | lectin receptor kinase a4.1 | chr5:214517-216583 REVERSE LENGTH=688 |