Probe CUST_3687_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_3687_PI426222305 | JHI_St_60k_v1 | DMT400064324 | GGACATCCAAATTTGGTTACAAGGGCAGTGAACATTAATTACCATTTCTCTTGCGTCTTT |
All Microarray Probes Designed to Gene DMG400024991
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_3687_PI426222305 | JHI_St_60k_v1 | DMT400064324 | GGACATCCAAATTTGGTTACAAGGGCAGTGAACATTAATTACCATTTCTCTTGCGTCTTT |
Microarray Signals from CUST_3687_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 7.47422 | 3.62055 | 0.973826 | 0.479419 |
| ABA 1h | 6.65319 | 3.50021 | 0.981035 | 0.524324 |
| ACC 1h | 6.82619 | 3.95839 | 0.872546 | 0.50557 |
| BABA 1h | 6.92579 | 3.86829 | 0.942077 | 0.525138 |
| Chitin 1h | 6.53157 | 3.68629 | 0.951978 | 0.533207 |
| Epi 1h | 6.07684 | 3.53219 | 0.919547 | 0.532865 |
| SA 1h | 9.06535 | 3.61545 | 1.03982 | 0.498699 |
| Me-JA 1h | 6.45029 | 3.75874 | 1.03212 | 0.597871 |
| Control 6h | 11.562 | 4.64218 | 1.30996 | 0.60557 |
| ABA 6h | 48.2304 | 7.82635 | 5.80212 | 0.867313 |
| ACC 6h | 37.0198 | 6.54283 | 4.10257 | 1.40887 |
| BABA 6h | 99.1634 | 28.7703 | 10.6841 | 3.1944 |
| Chitin 6h | 7.59888 | 4.41322 | 0.936372 | 0.542868 |
| Epi 6h | 10.019 | 4.45409 | 1.10967 | 0.539506 |
| SA 6h | 7.86566 | 4.12974 | 1.03775 | 0.553467 |
| Me-JA 6h | 7.51966 | 3.93877 | 0.983286 | 0.523021 |
Source Transcript PGSC0003DMT400064324 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |