Probe CUST_36159_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_36159_PI426222305 | JHI_St_60k_v1 | DMT400058534 | GCCAAATATGCTCAAAATACTCTTGTATGTACAAACTAGAGGACACTAGCTATTCACTTT |
All Microarray Probes Designed to Gene DMG400022738
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_36159_PI426222305 | JHI_St_60k_v1 | DMT400058534 | GCCAAATATGCTCAAAATACTCTTGTATGTACAAACTAGAGGACACTAGCTATTCACTTT |
Microarray Signals from CUST_36159_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 1107.34 | 156.445 | 0.859546 | 0.0631657 |
ABA 1h | 1130.95 | 183.162 | 0.984651 | 0.14073 |
ACC 1h | 903.901 | 172.724 | 0.67301 | 0.0906014 |
BABA 1h | 575.072 | 115.453 | 0.451077 | 0.054864 |
Chitin 1h | 582.838 | 52.1081 | 0.508851 | 0.0294886 |
Epi 1h | 661.402 | 95.3437 | 0.591678 | 0.0743609 |
SA 1h | 488.605 | 93.5022 | 0.363801 | 0.0468143 |
Me-JA 1h | 126.231 | 7.87526 | 0.122267 | 0.010702 |
Control 6h | 2573.87 | 567.022 | 1.92423 | 0.315582 |
ABA 6h | 1156.3 | 78.3033 | 0.856214 | 0.0740762 |
ACC 6h | 2332.29 | 296.619 | 1.58251 | 0.091399 |
BABA 6h | 2696.27 | 293.159 | 1.88419 | 0.204911 |
Chitin 6h | 3336.94 | 327.688 | 2.4541 | 0.32749 |
Epi 6h | 2109.9 | 122.114 | 1.4773 | 0.179817 |
SA 6h | 1819.91 | 372.279 | 1.392 | 0.166814 |
Me-JA 6h | 2526.48 | 561.592 | 1.91711 | 0.265879 |
Source Transcript PGSC0003DMT400058534 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT2G45680.1 | +1 | 8e-58 | 199 | 137/323 (42%) | TCP family transcription factor | chr2:18820717-18821787 REVERSE LENGTH=356 |