Probe CUST_35856_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_35856_PI426222305 | JHI_St_60k_v1 | DMT400024799 | AGATGATCAGTCGACTACCTCAACTACTACTAACGCTACTGGAACTACTAGCTCCGGTAA |
All Microarray Probes Designed to Gene DMG400009587
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_35856_PI426222305 | JHI_St_60k_v1 | DMT400024799 | AGATGATCAGTCGACTACCTCAACTACTACTAACGCTACTGGAACTACTAGCTCCGGTAA |
Microarray Signals from CUST_35856_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 809.675 | 141.91 | 1.60243 | 0.169945 |
| ABA 1h | 506.245 | 112.141 | 1.09971 | 0.210486 |
| ACC 1h | 1229.92 | 422.875 | 2.01515 | 0.932929 |
| BABA 1h | 828.938 | 239.613 | 1.57641 | 0.395712 |
| Chitin 1h | 596.116 | 86.0116 | 1.32258 | 0.0846681 |
| Epi 1h | 532.284 | 30.9502 | 1.25157 | 0.0727253 |
| SA 1h | 950.989 | 250.675 | 1.71657 | 0.498078 |
| Me-JA 1h | 910.442 | 177.866 | 2.16927 | 0.329553 |
| Control 6h | 204.381 | 54.5495 | 0.377725 | 0.0930813 |
| ABA 6h | 840.975 | 230.972 | 1.45234 | 0.465982 |
| ACC 6h | 482.039 | 48.0602 | 0.847607 | 0.0495467 |
| BABA 6h | 624.288 | 192.461 | 1.04205 | 0.276296 |
| Chitin 6h | 203.135 | 14.4713 | 0.386716 | 0.0237834 |
| Epi 6h | 226.04 | 54.0341 | 0.380352 | 0.0866131 |
| SA 6h | 165.012 | 54.5599 | 0.303786 | 0.0768255 |
| Me-JA 6h | 268.966 | 62.5687 | 0.523176 | 0.077621 |
Source Transcript PGSC0003DMT400024799 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G04340.1 | +1 | 3e-16 | 74 | 43/77 (56%) | zinc finger of Arabidopsis thaliana 6 | chr5:1216321-1217037 REVERSE LENGTH=238 |