Probe CUST_35529_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_35529_PI426222305 | JHI_St_60k_v1 | DMT400032516 | AAGAAGTACTCCGTAAGAAGCCCAATCGCAGTTGTGCTACAACCTACAATTGGTTTCTAG |
All Microarray Probes Designed to Gene DMG400012490
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_35529_PI426222305 | JHI_St_60k_v1 | DMT400032516 | AAGAAGTACTCCGTAAGAAGCCCAATCGCAGTTGTGCTACAACCTACAATTGGTTTCTAG |
Microarray Signals from CUST_35529_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 268.06 | 59.622 | 1.02936 | 0.161948 |
| ABA 1h | 133.317 | 17.5071 | 0.594642 | 0.104853 |
| ACC 1h | 242.595 | 39.7697 | 0.919817 | 0.0968551 |
| BABA 1h | 249.518 | 40.6263 | 1.00884 | 0.0758767 |
| Chitin 1h | 203.753 | 27.9782 | 0.891449 | 0.0703714 |
| Epi 1h | 205.358 | 12.3837 | 0.95261 | 0.0574154 |
| SA 1h | 305.31 | 58.5626 | 1.14416 | 0.199651 |
| Me-JA 1h | 172.054 | 25.7979 | 0.826851 | 0.0581333 |
| Control 6h | 381.924 | 99.5317 | 1.40222 | 0.316211 |
| ABA 6h | 108.748 | 7.38061 | 0.409023 | 0.0277092 |
| ACC 6h | 379.645 | 72.1329 | 1.28255 | 0.0920824 |
| BABA 6h | 370.853 | 30.7878 | 1.32122 | 0.0777168 |
| Chitin 6h | 297.845 | 31.8512 | 1.11153 | 0.111224 |
| Epi 6h | 350.885 | 57.4604 | 1.21179 | 0.315234 |
| SA 6h | 287.649 | 38.8736 | 1.1483 | 0.127387 |
| Me-JA 6h | 401.195 | 78.4338 | 1.54565 | 0.228905 |
Source Transcript PGSC0003DMT400032516 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G67360.1 | +1 | 0.0 | 577 | 335/717 (47%) | Subtilase family protein | chr5:26872192-26874465 REVERSE LENGTH=757 |