Probe CUST_32676_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_32676_PI426222305 | JHI_St_60k_v1 | DMT400047340 | GGCATTAACGGATCAACTAATTACATCTCTTCCAGCTAACATGCTTAATTACAAGTATGC |
All Microarray Probes Designed to Gene DMG400018397
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_32676_PI426222305 | JHI_St_60k_v1 | DMT400047340 | GGCATTAACGGATCAACTAATTACATCTCTTCCAGCTAACATGCTTAATTACAAGTATGC |
Microarray Signals from CUST_32676_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 5.49057 | 3.18565 | 0.922682 | 0.534772 |
| ABA 1h | 6.77583 | 3.09955 | 1.2505 | 0.614869 |
| ACC 1h | 6.77609 | 3.84697 | 1.09813 | 0.612329 |
| BABA 1h | 6.71294 | 3.36308 | 1.14075 | 0.595013 |
| Chitin 1h | 7.25081 | 3.19997 | 1.26873 | 0.623324 |
| Epi 1h | 5.89213 | 3.13543 | 1.14231 | 0.612352 |
| SA 1h | 5.52529 | 3.20122 | 0.904473 | 0.523766 |
| Me-JA 1h | 5.65478 | 3.28451 | 1.16217 | 0.673094 |
| Control 6h | 5.60427 | 3.24968 | 0.940708 | 0.545453 |
| ABA 6h | 39.0905 | 4.05351 | 6.14543 | 0.640057 |
| ACC 6h | 6.90445 | 4.06581 | 0.989396 | 0.567346 |
| BABA 6h | 6.25071 | 3.62923 | 0.937612 | 0.543268 |
| Chitin 6h | 6.41065 | 3.61677 | 1.0115 | 0.571515 |
| Epi 6h | 6.56908 | 3.8345 | 0.973488 | 0.564143 |
| SA 6h | 11.7593 | 5.98126 | 1.57353 | 1.23761 |
| Me-JA 6h | 5.6304 | 3.26789 | 0.95028 | 0.550962 |
Source Transcript PGSC0003DMT400047340 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT4G10265.1 | +1 | 4e-26 | 99 | 54/83 (65%) | Wound-responsive family protein | chr4:6373226-6373477 REVERSE LENGTH=83 |