Probe CUST_31716_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_31716_PI426222305 | JHI_St_60k_v1 | DMT400082356 | GATAGAAACATCCATATCTCCTTTCTCTCTTTTCTTACTATCAACCTCAAGTCTTCACAG |
All Microarray Probes Designed to Gene DMG400032496
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_31716_PI426222305 | JHI_St_60k_v1 | DMT400082356 | GATAGAAACATCCATATCTCCTTTCTCTCTTTTCTTACTATCAACCTCAAGTCTTCACAG |
Microarray Signals from CUST_31716_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 18.1879 | 3.31951 | 0.751804 | 0.141467 |
| ABA 1h | 16.8511 | 5.17247 | 0.713005 | 0.338923 |
| ACC 1h | 22.2931 | 8.41826 | 0.800994 | 0.271508 |
| BABA 1h | 24.8761 | 4.21036 | 1.05066 | 0.164259 |
| Chitin 1h | 25.047 | 3.53002 | 1.17006 | 0.167385 |
| Epi 1h | 22.3685 | 4.25102 | 1.05037 | 0.173309 |
| SA 1h | 22.8185 | 3.41078 | 0.917223 | 0.140836 |
| Me-JA 1h | 13.0905 | 3.36362 | 0.624452 | 0.203588 |
| Control 6h | 20.4436 | 5.7937 | 0.767311 | 0.215864 |
| ABA 6h | 62.7233 | 5.0103 | 2.48086 | 0.198143 |
| ACC 6h | 34.7241 | 8.62245 | 1.18245 | 0.575812 |
| BABA 6h | 41.0541 | 7.34526 | 1.49901 | 0.216567 |
| Chitin 6h | 35.3827 | 4.22151 | 1.3847 | 0.167376 |
| Epi 6h | 17.6005 | 4.00461 | 0.616024 | 0.155573 |
| SA 6h | 22.6312 | 5.59496 | 0.906317 | 0.357963 |
| Me-JA 6h | 24.2182 | 6.79282 | 0.947739 | 0.242322 |
Source Transcript PGSC0003DMT400082356 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT2G45490.1 | +3 | 2e-08 | 57 | 27/32 (84%) | ataurora3 | chr2:18747658-18749044 REVERSE LENGTH=288 |