Probe CUST_27734_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_27734_PI426222305 | JHI_St_60k_v1 | DMT400029823 | CATATAAAGCATTCGCTGGCAAAGACTCCAAGAAGTCTACATTAGAGATGCCTCTTCGGC |
All Microarray Probes Designed to Gene DMG400011460
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_27734_PI426222305 | JHI_St_60k_v1 | DMT400029823 | CATATAAAGCATTCGCTGGCAAAGACTCCAAGAAGTCTACATTAGAGATGCCTCTTCGGC |
Microarray Signals from CUST_27734_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 423.582 | 30.8395 | 0.945702 | 0.0551985 |
ABA 1h | 390.933 | 64.9541 | 0.966215 | 0.0893647 |
ACC 1h | 474.78 | 97.0886 | 0.990631 | 0.15428 |
BABA 1h | 468.838 | 87.6678 | 1.04687 | 0.112465 |
Chitin 1h | 388.797 | 60.7561 | 0.943465 | 0.106475 |
Epi 1h | 327.815 | 19.2794 | 0.84931 | 0.0499188 |
SA 1h | 600.895 | 121.641 | 1.2633 | 0.240471 |
Me-JA 1h | 719.868 | 111.348 | 1.93229 | 0.130436 |
Control 6h | 534.696 | 134.956 | 1.10168 | 0.243792 |
ABA 6h | 511.283 | 55.7257 | 1.06536 | 0.0833647 |
ACC 6h | 521.677 | 58.3526 | 1.00813 | 0.058864 |
BABA 6h | 538.958 | 54.9792 | 1.06893 | 0.0836394 |
Chitin 6h | 433.767 | 40.6391 | 0.906249 | 0.0590131 |
Epi 6h | 499.602 | 65.6188 | 0.977686 | 0.110622 |
SA 6h | 412.734 | 77.4843 | 0.900393 | 0.0844983 |
Me-JA 6h | 578.946 | 71.9315 | 1.28258 | 0.0813316 |
Source Transcript PGSC0003DMT400029823 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT1G08750.1 | +1 | 3e-12 | 62 | 39/99 (39%) | Peptidase C13 family | chr1:2801283-2804392 FORWARD LENGTH=388 |