Probe CUST_2648_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_2648_PI426222305 | JHI_St_60k_v1 | DMT400048331 | CTATACTTCTGATCATGTTGTTGGCTATACTGACTATCCATTTCTAGAAAATGTGGTATG |
All Microarray Probes Designed to Gene DMG400018779
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_2648_PI426222305 | JHI_St_60k_v1 | DMT400048331 | CTATACTTCTGATCATGTTGTTGGCTATACTGACTATCCATTTCTAGAAAATGTGGTATG |
Microarray Signals from CUST_2648_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 2076.65 | 408.957 | 0.734249 | 0.0954686 |
ABA 1h | 1486.23 | 121.653 | 0.611166 | 0.0353164 |
ACC 1h | 2032.5 | 610.768 | 0.648529 | 0.192874 |
BABA 1h | 1948.11 | 416.236 | 0.700747 | 0.0998372 |
Chitin 1h | 1373.75 | 79.6461 | 0.557871 | 0.0322423 |
Epi 1h | 1481.86 | 146.254 | 0.620915 | 0.0499659 |
SA 1h | 5981.63 | 479.147 | 2.11871 | 0.122331 |
Me-JA 1h | 3617.91 | 623.885 | 1.57789 | 0.131522 |
Control 6h | 3479.52 | 799.806 | 1.18966 | 0.215 |
ABA 6h | 3361.1 | 637.172 | 1.11167 | 0.17836 |
ACC 6h | 6021.95 | 513.043 | 1.90921 | 0.166089 |
BABA 6h | 4498.91 | 261.347 | 1.46737 | 0.0925942 |
Chitin 6h | 2550.99 | 147.681 | 0.875994 | 0.0505977 |
Epi 6h | 3142.3 | 265.545 | 1.01333 | 0.0585253 |
SA 6h | 6146.96 | 570.184 | 2.25812 | 0.252704 |
Me-JA 6h | 3812.13 | 313.902 | 1.39319 | 0.110692 |
Source Transcript PGSC0003DMT400048331 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT1G76690.1 | +1 | 0.0 | 538 | 256/345 (74%) | 12-oxophytodienoate reductase 2 | chr1:28778976-28780355 FORWARD LENGTH=374 |