Probe CUST_2379_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_2379_PI426222305 | JHI_St_60k_v1 | DMT400072433 | GAAATTCAGAGTACAAAGTGAAACAATGGTCTCAAAGGAATTAGTAACATCGGTACCAAA |
All Microarray Probes Designed to Gene DMG400028183
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_2379_PI426222305 | JHI_St_60k_v1 | DMT400072433 | GAAATTCAGAGTACAAAGTGAAACAATGGTCTCAAAGGAATTAGTAACATCGGTACCAAA |
Microarray Signals from CUST_2379_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 11.5149 | 3.64067 | 0.700383 | 0.234508 |
| ABA 1h | 14.4703 | 3.57165 | 1.00501 | 0.258946 |
| ACC 1h | 18.4949 | 8.24086 | 0.916438 | 0.399408 |
| BABA 1h | 13.7743 | 3.85793 | 0.886396 | 0.248883 |
| Chitin 1h | 7.94334 | 3.639 | 0.550428 | 0.255622 |
| Epi 1h | 8.35475 | 3.53779 | 0.594206 | 0.262753 |
| SA 1h | 6.1247 | 3.55659 | 0.371982 | 0.215552 |
| Me-JA 1h | 6.87873 | 3.75112 | 0.517377 | 0.284734 |
| Control 6h | 32.0683 | 5.45365 | 1.93366 | 0.288349 |
| ABA 6h | 33.7444 | 11.4238 | 1.77314 | 0.723791 |
| ACC 6h | 30.0516 | 13.6438 | 1.29561 | 0.544921 |
| BABA 6h | 26.0543 | 5.40095 | 1.3972 | 0.259349 |
| Chitin 6h | 36.4003 | 4.68237 | 2.12087 | 0.272759 |
| Epi 6h | 48.6767 | 7.12401 | 2.63874 | 0.30073 |
| SA 6h | 24.6735 | 4.33753 | 1.54183 | 0.278741 |
| Me-JA 6h | 9.63392 | 3.9451 | 0.586808 | 0.256127 |
Source Transcript PGSC0003DMT400072433 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | Solyc10g083940.1 | +1 | 0.0 | 1018 | 547/582 (94%) | evidence_code:10F0H1E1IEG genomic_reference:SL2.50ch10 gene_region:62966616-62968361 transcript_region:SL2.50ch10:62966616..62968361+ go_terms:GO:0055085 functional_description:Nodulin family protein (AHRD V1 ***- D7MWD3_ARALY); contains Interpro domain(s) IPR010658 Nodulin-like |
| TAIR PP10 | AT2G39210.1 | +1 | 0.0 | 684 | 364/572 (64%) | Major facilitator superfamily protein | chr2:16366287-16368231 REVERSE LENGTH=601 |