Probe CUST_22989_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_22989_PI426222305 | JHI_St_60k_v1 | DMT400076705 | TTCCAATTACCGCGACGACTCTGCTGGTGATACTTATATTGGCAACCTTAGATTTCACAG |
All Microarray Probes Designed to Gene DMG400029830
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_22989_PI426222305 | JHI_St_60k_v1 | DMT400076705 | TTCCAATTACCGCGACGACTCTGCTGGTGATACTTATATTGGCAACCTTAGATTTCACAG |
Microarray Signals from CUST_22989_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 146.051 | 58.1337 | 1.07641 | 0.36769 |
ABA 1h | 72.1719 | 18.6801 | 0.644978 | 0.141528 |
ACC 1h | 166.19 | 56.924 | 1.14397 | 0.519216 |
BABA 1h | 142.688 | 29.9185 | 1.19918 | 0.159556 |
Chitin 1h | 89.0698 | 10.0107 | 0.833702 | 0.0591498 |
Epi 1h | 86.5074 | 16.7605 | 0.817162 | 0.168168 |
SA 1h | 311.644 | 83.6835 | 2.34289 | 0.874489 |
Me-JA 1h | 63.2291 | 18.2127 | 0.600389 | 0.188641 |
Control 6h | 85.6802 | 30.9764 | 0.630836 | 0.201553 |
ABA 6h | 346.52 | 86.3178 | 2.57648 | 0.626724 |
ACC 6h | 263.957 | 67.5583 | 1.79636 | 0.558052 |
BABA 6h | 644.846 | 163.743 | 4.59941 | 1.16435 |
Chitin 6h | 152.484 | 13.9219 | 1.20939 | 0.111365 |
Epi 6h | 152.904 | 30.8396 | 1.11209 | 0.140622 |
SA 6h | 53.8278 | 8.2691 | 0.451195 | 0.0440477 |
Me-JA 6h | 151.651 | 106.9 | 0.75492 | 0.695162 |
Source Transcript PGSC0003DMT400076705 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT3G57270.1 | +3 | 8e-109 | 328 | 182/321 (57%) | beta-1,3-glucanase 1 | chr3:21191336-21193118 REVERSE LENGTH=340 |