Probe CUST_16946_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_16946_PI426222305 | JHI_St_60k_v1 | DMT400002991 | ATGGCGCTAGGTAGCAACACTATGACTTGAACAAGTTAGTCTTAACAAGAACCTGAAGGT |
All Microarray Probes Designed to Gene DMG400001178
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_16946_PI426222305 | JHI_St_60k_v1 | DMT400002991 | ATGGCGCTAGGTAGCAACACTATGACTTGAACAAGTTAGTCTTAACAAGAACCTGAAGGT |
Microarray Signals from CUST_16946_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 59.2421 | 19.5555 | 1.386 | 0.36963 |
ABA 1h | 115.159 | 21.0406 | 3.26093 | 0.379373 |
ACC 1h | 53.4968 | 13.6624 | 1.24215 | 0.288052 |
BABA 1h | 87.9015 | 12.0183 | 2.31164 | 0.40533 |
Chitin 1h | 37.3363 | 6.25132 | 1.03844 | 0.139139 |
Epi 1h | 52.897 | 4.52961 | 1.57538 | 0.136629 |
SA 1h | 90.17 | 13.5907 | 2.21375 | 0.454325 |
Me-JA 1h | 791.914 | 54.2546 | 24.9424 | 2.78192 |
Control 6h | 14.886 | 7.31823 | 0.306416 | 0.136577 |
ABA 6h | 48.2114 | 4.80919 | 1.16544 | 0.128249 |
ACC 6h | 14.3027 | 5.8024 | 0.27419 | 0.14892 |
BABA 6h | 13.7575 | 5.87554 | 0.26868 | 0.134128 |
Chitin 6h | 7.3585 | 4.26266 | 0.178473 | 0.103341 |
Epi 6h | 11.1861 | 4.66718 | 0.255842 | 0.105913 |
SA 6h | 9.55638 | 4.11211 | 0.235129 | 0.114364 |
Me-JA 6h | 19.1233 | 6.97099 | 0.414281 | 0.250063 |
Source Transcript PGSC0003DMT400002991 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT1G30135.1 | +3 | 2e-17 | 77 | 53/127 (42%) | jasmonate-zim-domain protein 8 | chr1:10596516-10597095 FORWARD LENGTH=131 |