Probe CUST_16940_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_16940_PI426222305 | JHI_St_60k_v1 | DMT400022651 | GAACCGTCATCACCATTATTACAACCTCAAACTGTGAAGAAATCTCTACAAAGATTTCTA |
All Microarray Probes Designed to Gene DMG400008782
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_16940_PI426222305 | JHI_St_60k_v1 | DMT400022651 | GAACCGTCATCACCATTATTACAACCTCAAACTGTGAAGAAATCTCTACAAAGATTTCTA |
Microarray Signals from CUST_16940_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 1805.26 | 343.733 | 2.67599 | 0.380013 |
ABA 1h | 1048.35 | 430.893 | 1.49573 | 0.653967 |
ACC 1h | 1161.63 | 539.833 | 1.31101 | 0.796831 |
BABA 1h | 1934.16 | 363.691 | 2.95 | 0.320408 |
Chitin 1h | 772.88 | 176.32 | 1.23596 | 0.37999 |
Epi 1h | 1335.34 | 194.147 | 2.30997 | 0.338214 |
SA 1h | 2205.72 | 249.36 | 3.24951 | 0.593675 |
Me-JA 1h | 14397.1 | 1051.65 | 26.908 | 1.55355 |
Control 6h | 373.305 | 76.8501 | 0.544759 | 0.0714754 |
ABA 6h | 191.854 | 39.6308 | 0.266011 | 0.0419397 |
ACC 6h | 204.713 | 29.4826 | 0.268217 | 0.0624366 |
BABA 6h | 282.082 | 61.9961 | 0.367576 | 0.083043 |
Chitin 6h | 190.379 | 17.4663 | 0.271817 | 0.0344431 |
Epi 6h | 219.825 | 31.2295 | 0.293375 | 0.048023 |
SA 6h | 307.944 | 38.4051 | 0.470533 | 0.117419 |
Me-JA 6h | 1183.52 | 188.741 | 1.77912 | 0.443797 |
Source Transcript PGSC0003DMT400022651 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT1G30135.1 | +3 | 2e-18 | 80 | 56/131 (43%) | jasmonate-zim-domain protein 8 | chr1:10596516-10597095 FORWARD LENGTH=131 |