Probe CUST_16918_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_16918_PI426222305 | JHI_St_60k_v1 | DMT400002985 | GTTGTACTACCTCCATCCACTTTTAATTGTCATATTGCGCTTTTCGAAAGTCTTGACTAA |
All Microarray Probes Designed to Gene DMG400001174
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_16918_PI426222305 | JHI_St_60k_v1 | DMT400002985 | GTTGTACTACCTCCATCCACTTTTAATTGTCATATTGCGCTTTTCGAAAGTCTTGACTAA |
Microarray Signals from CUST_16918_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 115.444 | 12.3623 | 1.9419 | 0.285658 |
ABA 1h | 51.0432 | 18.6616 | 0.830237 | 0.371802 |
ACC 1h | 70.5514 | 37.0744 | 0.863309 | 0.532997 |
BABA 1h | 83.35 | 16.553 | 1.41403 | 0.171337 |
Chitin 1h | 48.7974 | 7.99561 | 0.900224 | 0.204159 |
Epi 1h | 80.1862 | 18.8088 | 1.49247 | 0.363621 |
SA 1h | 82.327 | 16.9785 | 1.30985 | 0.309375 |
Me-JA 1h | 621.392 | 104.474 | 12.5446 | 1.65235 |
Control 6h | 62.7593 | 6.50031 | 1.05393 | 0.169055 |
ABA 6h | 35.9189 | 4.563 | 0.570807 | 0.07354 |
ACC 6h | 56.8912 | 5.60445 | 0.842044 | 0.081741 |
BABA 6h | 42.0111 | 7.89204 | 0.612629 | 0.11088 |
Chitin 6h | 54.1169 | 12.0801 | 0.814194 | 0.218601 |
Epi 6h | 40.9032 | 9.05593 | 0.583912 | 0.100568 |
SA 6h | 36.6305 | 8.97662 | 0.593657 | 0.233351 |
Me-JA 6h | 103.404 | 40.0742 | 1.54263 | 0.775033 |
Source Transcript PGSC0003DMT400002985 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT1G30135.1 | +1 | 2e-19 | 83 | 53/131 (40%) | jasmonate-zim-domain protein 8 | chr1:10596516-10597095 FORWARD LENGTH=131 |