Probe CUST_15298_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_15298_PI426222305 | JHI_St_60k_v1 | DMT400057334 | GCTGCTCTTTTGTATTTTCTGATAACTCTATCTCCAAATAAGTCATCAACACAGTGAACA |
All Microarray Probes Designed to Gene DMG400022264
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_15298_PI426222305 | JHI_St_60k_v1 | DMT400057334 | GCTGCTCTTTTGTATTTTCTGATAACTCTATCTCCAAATAAGTCATCAACACAGTGAACA |
Microarray Signals from CUST_15298_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 896.35 | 78.1406 | 1.72665 | 0.0998427 |
ABA 1h | 510.901 | 29.6605 | 1.12021 | 0.0979589 |
ACC 1h | 671.591 | 104.369 | 1.23698 | 0.109409 |
BABA 1h | 508.317 | 97.6408 | 0.98172 | 0.109697 |
Chitin 1h | 468.24 | 57.6409 | 0.996839 | 0.156965 |
Epi 1h | 437.283 | 32.1408 | 0.975578 | 0.0586902 |
SA 1h | 417.743 | 24.3057 | 0.789181 | 0.045886 |
Me-JA 1h | 147.122 | 8.99797 | 0.349344 | 0.0213216 |
Control 6h | 733.491 | 146.993 | 1.36204 | 0.192438 |
ABA 6h | 454.862 | 26.501 | 0.828943 | 0.0481848 |
ACC 6h | 559.217 | 134.919 | 0.893716 | 0.102458 |
BABA 6h | 610.359 | 129.168 | 1.01647 | 0.200933 |
Chitin 6h | 771.917 | 44.7242 | 1.40706 | 0.0814549 |
Epi 6h | 648.954 | 49.922 | 1.11074 | 0.171471 |
SA 6h | 463.957 | 68.1172 | 0.889624 | 0.0517788 |
Me-JA 6h | 421.174 | 76.574 | 0.790339 | 0.0977495 |
Source Transcript PGSC0003DMT400057334 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT5G56040.2 | +2 | 0.0 | 1301 | 723/1069 (68%) | Leucine-rich receptor-like protein kinase family protein | chr5:22695050-22698410 FORWARD LENGTH=1090 |