Probe CUST_13774_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_13774_PI426222305 | JHI_St_60k_v1 | DMT400018016 | CCTCCAGTCTTTTATCCTACAGTAATGTTCAATAAAGGTTTTGATTGAAACTACATGTCC |
All Microarray Probes Designed to Gene DMG400006998
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_13774_PI426222305 | JHI_St_60k_v1 | DMT400018016 | CCTCCAGTCTTTTATCCTACAGTAATGTTCAATAAAGGTTTTGATTGAAACTACATGTCC |
Microarray Signals from CUST_13774_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 477.706 | 106.864 | 4.51694 | 0.735909 |
ABA 1h | 381.332 | 22.2569 | 4.28748 | 0.377643 |
ACC 1h | 437.011 | 37.9231 | 4.20008 | 0.245128 |
BABA 1h | 265.281 | 68.9725 | 2.50335 | 0.552634 |
Chitin 1h | 220.26 | 56.4979 | 2.27822 | 0.554909 |
Epi 1h | 235.126 | 18.0685 | 2.68746 | 0.159647 |
SA 1h | 230.53 | 39.1954 | 2.17392 | 0.245482 |
Me-JA 1h | 145.394 | 24.147 | 1.71593 | 0.212321 |
Control 6h | 49.5293 | 5.23292 | 0.486253 | 0.0463246 |
ABA 6h | 16.0603 | 3.73019 | 0.149615 | 0.0350405 |
ACC 6h | 44.2893 | 7.97555 | 0.369646 | 0.0627757 |
BABA 6h | 50.4351 | 9.42497 | 0.430403 | 0.106081 |
Chitin 6h | 41.2959 | 7.56507 | 0.372175 | 0.0704301 |
Epi 6h | 31.1046 | 10.1478 | 0.233119 | 0.145139 |
SA 6h | 43.4466 | 9.76543 | 0.410746 | 0.0593451 |
Me-JA 6h | 46.7178 | 8.4692 | 0.452838 | 0.0819344 |
Source Transcript PGSC0003DMT400018016 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT3G07490.1 | +3 | 2e-69 | 218 | 119/149 (80%) | ARF-GAP domain 11 | chr3:2391189-2391650 FORWARD LENGTH=153 |