Probe CUST_10333_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_10333_PI426222305 | JHI_St_60k_v1 | DMT400028963 | CTCTGAAGAGTTCTTCGCTGTCATCTTCAACTTTTTCTGCTTTATCTTCAAATGCAAAAA |
All Microarray Probes Designed to Gene DMG400011149
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_10333_PI426222305 | JHI_St_60k_v1 | DMT400028963 | CTCTGAAGAGTTCTTCGCTGTCATCTTCAACTTTTTCTGCTTTATCTTCAAATGCAAAAA |
Microarray Signals from CUST_10333_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 21.0683 | 5.54053 | 0.366025 | 0.123104 |
| ABA 1h | 49.2686 | 22.1679 | 0.824843 | 0.445389 |
| ACC 1h | 20.9552 | 4.1837 | 0.378477 | 0.0831455 |
| BABA 1h | 44.9976 | 15.2898 | 0.740226 | 0.298525 |
| Chitin 1h | 50.801 | 5.89446 | 1.05776 | 0.0929773 |
| Epi 1h | 41.5486 | 4.15739 | 0.902343 | 0.0900195 |
| SA 1h | 38.3619 | 12.2636 | 0.645624 | 0.174367 |
| Me-JA 1h | 46.3838 | 17.3068 | 0.9519 | 0.270459 |
| Control 6h | 90.8989 | 12.7208 | 1.68677 | 0.125337 |
| ABA 6h | 39.8319 | 4.18402 | 0.70679 | 0.0746374 |
| ACC 6h | 61.8022 | 18.7949 | 0.894263 | 0.317405 |
| BABA 6h | 110.45 | 25.7842 | 1.75042 | 0.430389 |
| Chitin 6h | 87.0384 | 23.5568 | 1.44482 | 0.377286 |
| Epi 6h | 79.0164 | 17.3227 | 1.25878 | 0.403147 |
| SA 6h | 84.6392 | 6.05034 | 1.62153 | 0.206397 |
| Me-JA 6h | 114.629 | 28.5086 | 2.02045 | 0.479744 |
Source Transcript PGSC0003DMT400028963 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT1G30260.1 | +1 | 7e-12 | 62 | 28/38 (74%) | BEST Arabidopsis thaliana protein match is: Galactosyltransferase family protein (TAIR:AT4G21060.1); Has 30 Blast hits to 30 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:10651159-10651452 FORWARD LENGTH=97 |