Probe CUST_61_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_61_PI426222305 | JHI_St_60k_v1 | DMT400089070 | GATGCAATCAAGGAATTGAATATACAGGGCTGTCCAAAATCAATGAGAGTTGTAATTTAC |
All Microarray Probes Designed to Gene DMG400038641
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_61_PI426222305 | JHI_St_60k_v1 | DMT400089070 | GATGCAATCAAGGAATTGAATATACAGGGCTGTCCAAAATCAATGAGAGTTGTAATTTAC |
Microarray Signals from CUST_61_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 26.7359 | 7.65373 | 1.76895 | 0.373787 |
| ABA 1h | 15.6429 | 5.27809 | 1.08145 | 0.554513 |
| ACC 1h | 13.2188 | 4.03671 | 0.855123 | 0.317988 |
| BABA 1h | 8.97765 | 3.96234 | 0.651172 | 0.298483 |
| Chitin 1h | 13.6505 | 3.75037 | 1.07591 | 0.304388 |
| Epi 1h | 20.2496 | 3.64661 | 1.64432 | 0.30321 |
| SA 1h | 19.8763 | 3.81044 | 1.35367 | 0.272057 |
| Me-JA 1h | 12.6526 | 4.53467 | 0.9841 | 0.45087 |
| Control 6h | 17.8731 | 8.74155 | 1.00598 | 0.490064 |
| ABA 6h | 11.0129 | 4.13281 | 0.698897 | 0.292397 |
| ACC 6h | 14.2641 | 4.77853 | 0.797533 | 0.330828 |
| BABA 6h | 19.2443 | 5.12789 | 1.14095 | 0.343507 |
| Chitin 6h | 21.8531 | 7.2649 | 1.32352 | 0.391173 |
| Epi 6h | 21.7581 | 6.0807 | 1.23965 | 0.372932 |
| SA 6h | 12.8569 | 4.41937 | 0.82753 | 0.338564 |
| Me-JA 6h | 6.71424 | 3.89362 | 0.480304 | 0.278175 |
Source Transcript PGSC0003DMT400089070 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | Solyc01g057010.1 | +1 | 1e-93 | 289 | 163/379 (43%) | evidence_code:10F0H1E0IEG genomic_reference:SL2.50ch01 gene_region:50833554-50834726 transcript_region:SL2.50ch01:50833554..50834726+ functional_description:F-box family protein (AHRD V1 ***- B9GFB6_POPTR); contains Interpro domain(s) IPR017451 F-box associated type 1 |
| TAIR PP10 | AT4G12560.1 | +1 | 2e-28 | 114 | 104/379 (27%) | F-box and associated interaction domains-containing protein | chr4:7441815-7443157 FORWARD LENGTH=413 |